ID: 996280056

View in Genome Browser
Species Human (GRCh38)
Location 5:121719530-121719552
Sequence AATCATGTGAAACTACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996280056_996280058 18 Left 996280056 5:121719530-121719552 CCAGGCAGTAGTTTCACATGATT No data
Right 996280058 5:121719571-121719593 GAAAAAGCTGCATAAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996280056 Original CRISPR AATCATGTGAAACTACTGCC TGG (reversed) Intergenic
No off target data available for this crispr