ID: 996281011

View in Genome Browser
Species Human (GRCh38)
Location 5:121729011-121729033
Sequence CAACCACCTTAAGCATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996281007_996281011 7 Left 996281007 5:121728981-121729003 CCCTAAAATGTATAAAACTAACC No data
Right 996281011 5:121729011-121729033 CAACCACCTTAAGCATTCTCAGG No data
996281008_996281011 6 Left 996281008 5:121728982-121729004 CCTAAAATGTATAAAACTAACCT No data
Right 996281011 5:121729011-121729033 CAACCACCTTAAGCATTCTCAGG No data
996281006_996281011 23 Left 996281006 5:121728965-121728987 CCTATAATTCTTGTCTCCCTAAA No data
Right 996281011 5:121729011-121729033 CAACCACCTTAAGCATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996281011 Original CRISPR CAACCACCTTAAGCATTCTC AGG Intergenic
No off target data available for this crispr