ID: 996282345

View in Genome Browser
Species Human (GRCh38)
Location 5:121745773-121745795
Sequence CAGGGAATGAAGCATGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996282338_996282345 12 Left 996282338 5:121745738-121745760 CCCTAAAAGAAGGTCATAGCCAT No data
Right 996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG No data
996282339_996282345 11 Left 996282339 5:121745739-121745761 CCTAAAAGAAGGTCATAGCCATT No data
Right 996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG No data
996282337_996282345 18 Left 996282337 5:121745732-121745754 CCTCTTCCCTAAAAGAAGGTCAT No data
Right 996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG No data
996282342_996282345 -7 Left 996282342 5:121745757-121745779 CCATTTTGTGTACATGCAGGGAA No data
Right 996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996282345 Original CRISPR CAGGGAATGAAGCATGTTTG GGG Intergenic
No off target data available for this crispr