ID: 996290026

View in Genome Browser
Species Human (GRCh38)
Location 5:121841836-121841858
Sequence ACGATGACACAGAAGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996290026_996290030 9 Left 996290026 5:121841836-121841858 CCACTTTCCTTCTGTGTCATCGT No data
Right 996290030 5:121841868-121841890 AAGTAGTCACTAACACAGGGAGG No data
996290026_996290029 6 Left 996290026 5:121841836-121841858 CCACTTTCCTTCTGTGTCATCGT No data
Right 996290029 5:121841865-121841887 CATAAGTAGTCACTAACACAGGG No data
996290026_996290028 5 Left 996290026 5:121841836-121841858 CCACTTTCCTTCTGTGTCATCGT No data
Right 996290028 5:121841864-121841886 GCATAAGTAGTCACTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996290026 Original CRISPR ACGATGACACAGAAGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr