ID: 996291169

View in Genome Browser
Species Human (GRCh38)
Location 5:121853574-121853596
Sequence ACTAGATGCCTCCTCTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996291169_996291172 3 Left 996291169 5:121853574-121853596 CCAGAATAGAGGAGGCATCTAGT No data
Right 996291172 5:121853600-121853622 GTAGATGTTTTCTTTAGGCATGG No data
996291169_996291174 16 Left 996291169 5:121853574-121853596 CCAGAATAGAGGAGGCATCTAGT No data
Right 996291174 5:121853613-121853635 TTAGGCATGGAAGTGAGGAGTGG No data
996291169_996291173 11 Left 996291169 5:121853574-121853596 CCAGAATAGAGGAGGCATCTAGT No data
Right 996291173 5:121853608-121853630 TTTCTTTAGGCATGGAAGTGAGG No data
996291169_996291175 17 Left 996291169 5:121853574-121853596 CCAGAATAGAGGAGGCATCTAGT No data
Right 996291175 5:121853614-121853636 TAGGCATGGAAGTGAGGAGTGGG No data
996291169_996291171 -2 Left 996291169 5:121853574-121853596 CCAGAATAGAGGAGGCATCTAGT No data
Right 996291171 5:121853595-121853617 GTCAGGTAGATGTTTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996291169 Original CRISPR ACTAGATGCCTCCTCTATTC TGG (reversed) Intergenic