ID: 996294542

View in Genome Browser
Species Human (GRCh38)
Location 5:121896105-121896127
Sequence CTCAAAACACAGATAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996294539_996294542 -4 Left 996294539 5:121896086-121896108 CCTCAAAGACAGGAGAAAACTCA No data
Right 996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996294542 Original CRISPR CTCAAAACACAGATAAGGGA AGG Intergenic
No off target data available for this crispr