ID: 996304549

View in Genome Browser
Species Human (GRCh38)
Location 5:122032176-122032198
Sequence TCACATATACTGAAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996304549_996304553 -2 Left 996304549 5:122032176-122032198 CCTCCTCCCTTCAGTATATGTGA 0: 1
1: 0
2: 1
3: 16
4: 211
Right 996304553 5:122032197-122032219 GAAATGTAGTGAAATTTATATGG 0: 1
1: 0
2: 2
3: 21
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996304549 Original CRISPR TCACATATACTGAAGGGAGG AGG (reversed) Intronic
901911087 1:12458800-12458822 TCACAGTCACTGAAGGGAAGAGG - Intronic
901911582 1:12463185-12463207 TCATATATCCTCAAAGGAGGGGG + Intronic
909091274 1:71228997-71229019 TCACATTTAGTGAGGGGTGGAGG - Intergenic
909580129 1:77224023-77224045 TGACAGAAACTGAAGGGAGAGGG + Intergenic
912782423 1:112564205-112564227 TGACTTATACTGAAGGGAAAAGG + Intronic
912860782 1:113211916-113211938 AAACATGTACTGAATGGAGGAGG - Intergenic
915053530 1:153103239-153103261 TCACATCTACTGATGAGAAGAGG - Intronic
915524433 1:156467321-156467343 ACACATATGCTGCAGGAAGGGGG - Exonic
917012825 1:170494502-170494524 CCAGATATATTGGAGGGAGGAGG - Intergenic
919485485 1:198141440-198141462 TCACATAAACTTAAGGTAAGGGG - Intergenic
920730152 1:208475769-208475791 TGGCATATACTGAAGGGATGAGG + Intergenic
921873205 1:220164227-220164249 TCACAGATAGTGAAGGAAAGAGG - Intronic
922673186 1:227530550-227530572 TCACATAAACTTAAGGAAAGTGG - Intergenic
922692501 1:227706004-227706026 TTACATATAGTGCAGGGAGATGG - Intergenic
922773065 1:228199626-228199648 TGACCTATACTGGAGGGAGAGGG - Intergenic
1065835668 10:29655695-29655717 TCACAAATACTGAACAGAAGTGG + Intronic
1065894385 10:30150222-30150244 TCACATAAACTTAAGGTAGGGGG - Intergenic
1066215213 10:33279764-33279786 TGATAGGTACTGAAGGGAGGAGG + Intronic
1068163392 10:53297401-53297423 TCCCATACACTGAAGTGAGATGG - Intergenic
1068480975 10:57587591-57587613 TCACATAAACTTAAAGGAGGGGG + Intergenic
1068589655 10:58840486-58840508 CCACATAGACTGAATGGAAGAGG + Intergenic
1073702284 10:105941447-105941469 TTACATATACTGCACGGAGCAGG - Intergenic
1073930460 10:108568118-108568140 TCACATTTCCCGAGGGGAGGAGG - Intergenic
1074096579 10:110318591-110318613 TCACATTTGTTGAAGGGAGGGGG - Intergenic
1075581032 10:123618629-123618651 TCACATATAATCAATGTAGGAGG - Intergenic
1077923856 11:6661440-6661462 TCTCATTTACTCAGGGGAGGGGG - Intergenic
1078537708 11:12188007-12188029 CCACATATATGGATGGGAGGAGG - Intronic
1079835647 11:25329208-25329230 TGATGTATACGGAAGGGAGGGGG + Intergenic
1079868922 11:25771014-25771036 TCACAGATGCTGACTGGAGGTGG + Intergenic
1081493392 11:43583526-43583548 TCACTTATTGTGAAGGGAAGGGG - Intronic
1081869510 11:46376956-46376978 GCACAAACACTGAAAGGAGGTGG - Intronic
1082753565 11:57048894-57048916 CCACAGATGCTGAAGGGAGCAGG + Intergenic
1084271760 11:68032909-68032931 TCACATACTCTGCAGAGAGGCGG - Exonic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1085653019 11:78285582-78285604 TCCCATTTACTGAAGAGAGGCGG - Intronic
1086867619 11:91999054-91999076 ACATATATAGAGAAGGGAGGAGG + Intergenic
1087418294 11:97886926-97886948 TTACATATAATAAAGGTAGGTGG + Intergenic
1090161000 11:124495477-124495499 TCCCAAATACTGAAGAGAGCTGG - Intergenic
1090282638 11:125469296-125469318 TCACCTAGACTGAAGGGGAGTGG + Intronic
1090559294 11:127913378-127913400 TCACATAAACTTAAGGTAAGGGG - Intergenic
1093114936 12:15197797-15197819 ACACACATACTGAAGACAGGTGG - Intronic
1094277772 12:28698018-28698040 TCACATGTTTTGAAGGGAGAGGG + Intergenic
1095500850 12:42837275-42837297 TCACATAAACTTAAGGTAAGGGG - Intergenic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1097861147 12:64519948-64519970 TCACGTACACAGAAGGCAGGGGG - Intergenic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1098786261 12:74760243-74760265 TCACATAAACTTAAGGTAGAGGG - Intergenic
1099369862 12:81815843-81815865 TCACATAAACAGAAGGAAAGAGG + Intergenic
1104524472 12:129505888-129505910 TCACATAAACTTAAGGTAGAGGG - Intronic
1106392051 13:29344514-29344536 TCACATAAACTTAAGGTAGAGGG - Intronic
1106688572 13:32089362-32089384 TCACATAGGTTGAAGGCAGGGGG + Intronic
1109058131 13:57579217-57579239 TCACATAAACTTAAGGTAAGAGG - Intergenic
1110720482 13:78755614-78755636 CCACATATACTGAAAGTAGTAGG - Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1112121302 13:96414954-96414976 TCTCATTTTTTGAAGGGAGGGGG - Intronic
1113132787 13:107056851-107056873 GCACATAAAAAGAAGGGAGGGGG - Intergenic
1113438873 13:110313226-110313248 TCTCATTAACTGAAGGGAGTGGG - Intronic
1115508731 14:34118744-34118766 TCACATACACTGCATGGGGGGGG + Intronic
1115723977 14:36193249-36193271 TCTCATTTTCTGAAAGGAGGCGG + Intergenic
1115798983 14:36971118-36971140 TCACAAATACTGAAGGGACTCGG - Intronic
1119981970 14:79091760-79091782 TCACACATTCTGAAGTAAGGTGG + Intronic
1120257517 14:82139580-82139602 TCCCATATGCTGATTGGAGGTGG - Intergenic
1120736162 14:88055613-88055635 TCACATAAACTTAAGGTAAGGGG - Intergenic
1121234167 14:92380099-92380121 CCACAGACACTGAAGGCAGGAGG + Intronic
1122545988 14:102523127-102523149 TCACCTATGCTGGAGGGAAGTGG - Intergenic
1123912204 15:24978832-24978854 TCACATTATCTGAAGGGAAGTGG + Intergenic
1123977377 15:25566089-25566111 TCACATACACAGTAGGGAGCAGG + Intergenic
1124962791 15:34410664-34410686 TCGCAGATGCTGAAGCGAGGCGG + Intronic
1124979417 15:34556886-34556908 TCGCAGATGCTGAAGCGAGGAGG + Intronic
1125143474 15:36438303-36438325 TCAGAAATAATGAAGGGAGATGG - Intergenic
1125954532 15:43780603-43780625 TCACAGATACAGAAGGCAGAAGG - Intronic
1126190755 15:45875587-45875609 TCACATACACTTAAGGAAAGGGG + Intergenic
1127996412 15:64155577-64155599 TAACATAGACTGGAGGGTGGTGG + Exonic
1129454405 15:75669087-75669109 ACACATGAACTGAAGGAAGGAGG - Intergenic
1131022197 15:89108363-89108385 ACACAGATACAGAGGGGAGGAGG - Intronic
1131477434 15:92752194-92752216 TCACATATCACAAAGGGAGGAGG - Intronic
1132461149 16:55561-55583 CCACATAACCTGAAGGGAGGAGG - Intronic
1134306027 16:13033260-13033282 TGACCTGGACTGAAGGGAGGCGG + Intronic
1135203046 16:20455924-20455946 TCACATAAACTTAAGGTAAGGGG + Intronic
1135216053 16:20571937-20571959 TCACATAAACTTAAGGTAAGGGG - Intronic
1137523911 16:49217139-49217161 CCACATGTACTGAGTGGAGGTGG - Intergenic
1140238497 16:73180444-73180466 CTACAAATACAGAAGGGAGGCGG + Intergenic
1142297104 16:89231488-89231510 TCACCTCCAGTGAAGGGAGGGGG - Exonic
1142715811 17:1746350-1746372 TCACATAGACAGATGGGTGGGGG - Intronic
1146551552 17:33784387-33784409 TCACATTCACTTGAGGGAGGAGG - Intronic
1146776727 17:35625604-35625626 TCACTTATTCTGAAGGATGGGGG + Intronic
1147005892 17:37403728-37403750 TAACATCAACTGAAGGGAGAGGG + Intronic
1147193156 17:38748638-38748660 ACCCATATTTTGAAGGGAGGGGG - Intronic
1148486982 17:47996792-47996814 TCAGAGAAACTGGAGGGAGGGGG + Intergenic
1150754872 17:67902538-67902560 TCTCATAAGCTGATGGGAGGAGG - Intronic
1151332426 17:73418452-73418474 TCACTAATCCTGAAGGGCGGTGG - Intronic
1151896234 17:76982719-76982741 TCACAGACTCTGAGGGGAGGTGG + Intergenic
1152380470 17:79939833-79939855 TCACAGGTCCTGAAGGGAAGTGG + Exonic
1153164471 18:2246231-2246253 TCACATAAACTTAAGGAAAGAGG + Intergenic
1154219691 18:12441157-12441179 TCACTTGAACTGGAGGGAGGGGG + Intergenic
1155067345 18:22279350-22279372 TTAGAGAGACTGAAGGGAGGTGG - Intergenic
1158756709 18:60333714-60333736 TCACATAAACTTAAAGGGGGGGG + Intergenic
1159641624 18:70869874-70869896 TCACAGATAAAGAAGAGAGGAGG - Intergenic
1160774341 19:848196-848218 TCCCATATAGGGAGGGGAGGGGG + Intergenic
1162796436 19:13089841-13089863 TCTCAGGTACTGAAGAGAGGGGG - Intronic
925356994 2:3248679-3248701 TCACTTATACTGGAAGGCGGAGG + Intronic
925898730 2:8493646-8493668 TCACATCTAGTTGAGGGAGGTGG - Intergenic
926889650 2:17628346-17628368 TGATATATAGTGTAGGGAGGAGG + Intronic
927664227 2:25018610-25018632 TCCCATCTACTGGAGGGCGGGGG - Intergenic
927769372 2:25845717-25845739 TCACAGGTAGTGAAGGGATGTGG - Intronic
928242557 2:29599434-29599456 TCATATTTAAGGAAGGGAGGAGG + Intronic
928685193 2:33742545-33742567 TCACATATACTTAAGGTAAAGGG - Intergenic
933576706 2:84077627-84077649 TCACATAAAATGAAGGGAGATGG - Intergenic
934536368 2:95137610-95137632 TCAAATATCATGAAGGGAGGAGG - Intronic
934819407 2:97359106-97359128 AGACAGAGACTGAAGGGAGGTGG - Intergenic
935480615 2:103583823-103583845 TTACATAAACTGAAGGGAATGGG - Intergenic
937569668 2:123340955-123340977 TCACCCATGCTGGAGGGAGGTGG - Intergenic
938599633 2:132823832-132823854 TCACATAAACCTAAGGGATGGGG + Intronic
942146133 2:173028586-173028608 TCACCTAAACAGAAGGGAGAGGG - Intronic
942864161 2:180651721-180651743 TCATATAAACTGCAAGGAGGTGG - Intergenic
943120142 2:183725223-183725245 TCACAGATAATGATGGGATGTGG + Intergenic
943305645 2:186258290-186258312 GAAAATATACTGAAGGGAGGAGG + Intergenic
946465318 2:219906701-219906723 TCCTATATGCTGAAGGGATGGGG + Intergenic
946512576 2:220375154-220375176 TCACATATCCTGTAAGGAGTTGG + Intergenic
1170328110 20:15178662-15178684 TATCATATGCTGATGGGAGGAGG - Intronic
1170428283 20:16256893-16256915 TCTGATAGACTGAAGGAAGGAGG + Intergenic
1171171096 20:23015901-23015923 ACACACAGACTGATGGGAGGAGG - Intergenic
1173809544 20:45947753-45947775 TAACATATCCTGCGGGGAGGAGG + Exonic
1174840167 20:53893887-53893909 ACATATATACTTAAGGGTGGAGG - Intergenic
1175153747 20:56955255-56955277 TCAAAAATACTGGAGAGAGGTGG + Intergenic
1177777014 21:25579217-25579239 TTACATATATTGAAGGAAAGGGG - Intergenic
1180247787 21:46559904-46559926 TCACATGAACTCATGGGAGGGGG - Intronic
1182203010 22:28592655-28592677 TCATGAATACAGAAGGGAGGAGG - Intronic
1182515401 22:30855953-30855975 TCACATAGCCTGCAGGGATGAGG - Intronic
1184441466 22:44519192-44519214 TCACCTAGACTGGAGTGAGGTGG - Intergenic
1185138523 22:49087640-49087662 CCACATACACTGAGGTGAGGGGG + Intergenic
949749515 3:7334694-7334716 TCACATAAACTTAAGGTAAGTGG + Intronic
950092062 3:10302989-10303011 TCACATAGACAGAAAGGAGAAGG + Intronic
952825987 3:37525468-37525490 TCACATAGAGTGAGGGGTGGAGG + Intronic
953259584 3:41324608-41324630 TCACCTATTCAGAAGGCAGGTGG + Intronic
953382392 3:42482215-42482237 TCACATAAACTTAAGGTAAGGGG + Intergenic
955006065 3:54970018-54970040 TGTCATAAACTGATGGGAGGTGG - Intronic
955158615 3:56442739-56442761 TCAGGTATTCTGAAGGGAAGAGG - Intronic
955974532 3:64467640-64467662 TCACCTAGACTGAAGGTTGGGGG - Intergenic
956156230 3:66300748-66300770 TAGCATATACTAAAGGGAGGTGG + Intronic
959631515 3:108512443-108512465 TCACACATACAGAGAGGAGGAGG - Intronic
959666335 3:108926291-108926313 TCACATAAACTTAAGGTAAGGGG - Intronic
960407708 3:117282422-117282444 TCAGAAATACAGAATGGAGGTGG + Intergenic
960516731 3:118610092-118610114 TCACATAAACTTAAGGTAAGGGG + Intergenic
962462360 3:135625973-135625995 TCACAAATACTGGAGGGAGGTGG - Intergenic
963288678 3:143464519-143464541 GCACCTATACTAAAGGGAGGAGG - Intronic
964075853 3:152690563-152690585 TCACATAAACTTAAGGGAAAGGG + Intergenic
965316144 3:167193252-167193274 TCACATGTCCTGAATGGGGGTGG + Intergenic
966169054 3:177056911-177056933 GCATATATACTGAATTGAGGAGG - Intronic
968685319 4:1954099-1954121 TCCCAGCTACTGAAGGGATGAGG - Intronic
969378879 4:6781928-6781950 TCACATTTAGGGAAGGTAGGTGG + Intronic
970123237 4:12780667-12780689 TCACATATAATCAATGGATGTGG - Intergenic
970566249 4:17335004-17335026 TCACAGATACTGAATGGGGGTGG - Intergenic
971050218 4:22853671-22853693 TCACATAAACTTAAGGTAGAGGG - Intergenic
971402609 4:26290157-26290179 TCACATGTAGAGATGGGAGGTGG - Intronic
971796014 4:31229415-31229437 TGATTTATAGTGAAGGGAGGTGG + Intergenic
974451959 4:62075223-62075245 TCACAAAGACTGAAGGGCAGTGG + Intronic
975668314 4:76755128-76755150 TCACATACAGTGTGGGGAGGAGG - Exonic
977258711 4:94770922-94770944 ACACATATAATCATGGGAGGGGG - Intronic
978401673 4:108337515-108337537 GCACATACACAGAAGGGAGTGGG + Intergenic
978990126 4:115070390-115070412 TGACAGATACTGGAGGGTGGAGG + Intronic
979357180 4:119717989-119718011 TCACATAAACTTAAGGTAAGGGG + Intergenic
980974327 4:139596459-139596481 CCAAATACACTTAAGGGAGGGGG + Intronic
986163408 5:5251606-5251628 GCACAGAGACTGAAGGGAGATGG + Intronic
986862549 5:11944332-11944354 ACAGATATACGGAAGGGAAGGGG - Intergenic
989580280 5:43026394-43026416 TCACCTATACTGCAGTGTGGTGG + Intergenic
992961156 5:81957693-81957715 TGACATGTAGGGAAGGGAGGGGG - Intergenic
994051116 5:95363866-95363888 TCACATAAACTTAAGGTAGAGGG - Intergenic
996235538 5:121125721-121125743 TCCCATCTACTGAAGAGAGAGGG + Intergenic
996304549 5:122032176-122032198 TCACATATACTGAAGGGAGGAGG - Intronic
999501540 5:152151651-152151673 TGACACATACAGAAGAGAGGAGG - Intergenic
1000894670 5:166841253-166841275 TTAAATATACTGTAGTGAGGGGG - Intergenic
1001789940 5:174447470-174447492 ACACACACACTGAAGAGAGGAGG + Intergenic
1004411627 6:15386462-15386484 TCAACTGTACTGAAGGGAGAAGG - Intronic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1007369783 6:41418887-41418909 TAACATATACTTGAGGAAGGTGG - Intergenic
1007999530 6:46344552-46344574 ACACAAATATTGAGGGGAGGTGG + Intronic
1008289763 6:49700343-49700365 ACACATATCCTGAAGGAAGGGGG + Intronic
1008499708 6:52169057-52169079 TAACAGAGACTGAAGTGAGGTGG - Intergenic
1009389517 6:63129102-63129124 TCACATAAACTTAAGGTAAGGGG - Intergenic
1009448151 6:63768043-63768065 ACATATATAATGAAGGGAAGGGG - Intronic
1009631350 6:66204890-66204912 TACTATATATTGAAGGGAGGAGG + Intergenic
1010051327 6:71507719-71507741 TCACATATACAGCATTGAGGTGG - Intergenic
1010451566 6:76009807-76009829 TTTCATTTATTGAAGGGAGGTGG + Intronic
1010593453 6:77736658-77736680 TCACAAATACTGAATTAAGGGGG - Intronic
1014278411 6:119414610-119414632 TTACATAAACTTAAGGGAGAGGG - Intergenic
1014410305 6:121109052-121109074 TCACATATAAGAAAGGGAAGGGG + Intronic
1017530330 6:155284011-155284033 TCTGAGATGCTGAAGGGAGGTGG + Intronic
1017704123 6:157105172-157105194 TCAAATAAACTCAAGGGAGATGG + Intronic
1018745449 6:166758136-166758158 TCATTTAAACTGAAAGGAGGAGG + Intronic
1020458779 7:8404521-8404543 TTTCAGGTACTGAAGGGAGGGGG + Intergenic
1021091439 7:16487335-16487357 GCACATTTACTCAAGGGAAGTGG - Intronic
1023692645 7:42807363-42807385 TCACATAAACTTAAGGTAAGGGG + Intergenic
1023707648 7:42958549-42958571 TCACAGAGACTGAAGTGAAGTGG - Intergenic
1023852451 7:44157997-44158019 AGACTTATTCTGAAGGGAGGTGG + Intronic
1027268017 7:76504618-76504640 TCACATAGCCTCGAGGGAGGAGG + Intronic
1027319828 7:77004480-77004502 TCACATAGCCTCGAGGGAGGAGG + Intergenic
1028197376 7:87922533-87922555 TCACATAAACTTAAGGGAAAGGG + Intergenic
1028493321 7:91438313-91438335 TGACATTTAGTGATGGGAGGAGG + Intergenic
1031420390 7:121544563-121544585 TCAAATGAACTGAATGGAGGAGG - Intergenic
1032439160 7:131928633-131928655 TGACACAGACTGAAGTGAGGTGG + Intergenic
1033028746 7:137804209-137804231 TCACATATCCAGTAGAGAGGGGG - Intronic
1033588639 7:142792608-142792630 TCACAGACACTGGAGGGTGGAGG + Intergenic
1034401945 7:150868148-150868170 TAACATCAACTGAAGGGAGAAGG + Intergenic
1034489973 7:151387859-151387881 TCACATCTGCTGAGGGGTGGAGG - Intronic
1036296484 8:7542034-7542056 TCCCAGATGCTGCAGGGAGGGGG + Exonic
1036326082 8:7778985-7779007 TCCCAGATGCTGCAGGGAGGGGG - Exonic
1037903068 8:22699293-22699315 TAACATTTACTGGAGGGATGAGG + Intergenic
1039683369 8:39767035-39767057 TGACATAAACTGATGGGATGAGG + Exonic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1040870805 8:52098686-52098708 CCACGTGTCCTGAAGGGAGGAGG + Intergenic
1042160779 8:65892218-65892240 TCACATAAACTTAAGGAAAGGGG + Intergenic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1043470172 8:80554373-80554395 TCATTTATATTGAAGGAAGGGGG - Intergenic
1043679713 8:83008098-83008120 GCACAGATACTGTAGAGAGGAGG + Intergenic
1046937965 8:119903942-119903964 TAACATTTACAGAAGGGAGGTGG - Intronic
1047890252 8:129301084-129301106 TCACATAAACTTAAGGTAGAGGG - Intergenic
1048168151 8:132081778-132081800 TCATGTGTACGGAAGGGAGGGGG + Intronic
1051546987 9:18287892-18287914 TTACATATACTTCAGGGAGTAGG - Intergenic
1056396895 9:86189476-86189498 TCACATAAACTTAAGGTAAGGGG + Intergenic
1056780555 9:89546530-89546552 TGACATATTCGGAAGAGAGGAGG - Intergenic
1057009616 9:91589827-91589849 TCACAGACACTGATGGGTGGAGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1059719224 9:116943151-116943173 GCTCATAGACTGAAGGGAAGGGG + Intronic
1186700726 X:12087151-12087173 TCACTTATACTCAAGGGGAGGGG + Intergenic
1187752002 X:22477082-22477104 TCACATAAACTTAAGGTATGGGG - Intergenic
1188132151 X:26449371-26449393 TCACTTCTCCTGAAGGGGGGAGG + Intergenic
1188228394 X:27630476-27630498 TCAAAAATGCTGAAGAGAGGGGG + Intronic
1193723412 X:85014188-85014210 TCACATATACTTAAGGTAAAGGG - Intronic