ID: 996307082

View in Genome Browser
Species Human (GRCh38)
Location 5:122059655-122059677
Sequence CTGCAGTTCTTGAAGAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996307080_996307082 1 Left 996307080 5:122059631-122059653 CCATGTTACTGTCATTCAACTTC 0: 1
1: 0
2: 1
3: 15
4: 225
Right 996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG No data
996307079_996307082 2 Left 996307079 5:122059630-122059652 CCCATGTTACTGTCATTCAACTT 0: 1
1: 0
2: 3
3: 17
4: 229
Right 996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996307082 Original CRISPR CTGCAGTTCTTGAAGAACAT GGG Intronic
No off target data available for this crispr