ID: 996312420

View in Genome Browser
Species Human (GRCh38)
Location 5:122121881-122121903
Sequence TTTGTTATATCCTCTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996312420_996312427 27 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312427 5:122121931-122121953 AAAGACCAGGTTCACCTGGCTGG No data
996312420_996312425 14 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312425 5:122121918-122121940 GAGAGAATCTGGTAAAGACCAGG No data
996312420_996312424 3 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312424 5:122121907-122121929 GGCATATGCAAGAGAGAATCTGG No data
996312420_996312428 28 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312428 5:122121932-122121954 AAGACCAGGTTCACCTGGCTGGG No data
996312420_996312426 23 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312426 5:122121927-122121949 TGGTAAAGACCAGGTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996312420 Original CRISPR TTTGTTATATCCTCTGGACC TGG (reversed) Intergenic
No off target data available for this crispr