ID: 996312423

View in Genome Browser
Species Human (GRCh38)
Location 5:122121887-122121909
Sequence GCCCTATTTGTTATATCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996312423_996312425 8 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312425 5:122121918-122121940 GAGAGAATCTGGTAAAGACCAGG No data
996312423_996312426 17 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312426 5:122121927-122121949 TGGTAAAGACCAGGTTCACCTGG No data
996312423_996312427 21 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312427 5:122121931-122121953 AAAGACCAGGTTCACCTGGCTGG No data
996312423_996312428 22 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312428 5:122121932-122121954 AAGACCAGGTTCACCTGGCTGGG No data
996312423_996312424 -3 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312424 5:122121907-122121929 GGCATATGCAAGAGAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996312423 Original CRISPR GCCCTATTTGTTATATCCTC TGG (reversed) Intergenic