ID: 996312425

View in Genome Browser
Species Human (GRCh38)
Location 5:122121918-122121940
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996312423_996312425 8 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312425 5:122121918-122121940 GAGAGAATCTGGTAAAGACCAGG No data
996312420_996312425 14 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312425 5:122121918-122121940 GAGAGAATCTGGTAAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type