ID: 996312426

View in Genome Browser
Species Human (GRCh38)
Location 5:122121927-122121949
Sequence TGGTAAAGACCAGGTTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996312423_996312426 17 Left 996312423 5:122121887-122121909 CCAGAGGATATAACAAATAGGGC No data
Right 996312426 5:122121927-122121949 TGGTAAAGACCAGGTTCACCTGG No data
996312420_996312426 23 Left 996312420 5:122121881-122121903 CCAGGTCCAGAGGATATAACAAA No data
Right 996312426 5:122121927-122121949 TGGTAAAGACCAGGTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996312426 Original CRISPR TGGTAAAGACCAGGTTCACC TGG Intergenic
No off target data available for this crispr