ID: 996312427 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:122121931-122121953 |
| Sequence | AAAGACCAGGTTCACCTGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996312420_996312427 | 27 | Left | 996312420 | 5:122121881-122121903 | CCAGGTCCAGAGGATATAACAAA | No data | ||
| Right | 996312427 | 5:122121931-122121953 | AAAGACCAGGTTCACCTGGCTGG | No data | ||||
| 996312423_996312427 | 21 | Left | 996312423 | 5:122121887-122121909 | CCAGAGGATATAACAAATAGGGC | No data | ||
| Right | 996312427 | 5:122121931-122121953 | AAAGACCAGGTTCACCTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996312427 | Original CRISPR | AAAGACCAGGTTCACCTGGC TGG | Intergenic | ||