ID: 996312428 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:122121932-122121954 |
Sequence | AAGACCAGGTTCACCTGGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
996312423_996312428 | 22 | Left | 996312423 | 5:122121887-122121909 | CCAGAGGATATAACAAATAGGGC | No data | ||
Right | 996312428 | 5:122121932-122121954 | AAGACCAGGTTCACCTGGCTGGG | No data | ||||
996312420_996312428 | 28 | Left | 996312420 | 5:122121881-122121903 | CCAGGTCCAGAGGATATAACAAA | No data | ||
Right | 996312428 | 5:122121932-122121954 | AAGACCAGGTTCACCTGGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
996312428 | Original CRISPR | AAGACCAGGTTCACCTGGCT GGG | Intergenic | ||