ID: 996313805

View in Genome Browser
Species Human (GRCh38)
Location 5:122138337-122138359
Sequence ATGCAAACCCACAATAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996313799_996313805 11 Left 996313799 5:122138303-122138325 CCCTCACTGTCTAATTCCTTACC 0: 1
1: 0
2: 0
3: 31
4: 272
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313796_996313805 24 Left 996313796 5:122138290-122138312 CCTTTTCCCTTTTCCCTCACTGT 0: 1
1: 0
2: 7
3: 105
4: 1081
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313801_996313805 -5 Left 996313801 5:122138319-122138341 CCTTACCTTGCATTTCACATGCA 0: 1
1: 0
2: 0
3: 21
4: 225
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313802_996313805 -10 Left 996313802 5:122138324-122138346 CCTTGCATTTCACATGCAAACCC 0: 1
1: 0
2: 2
3: 17
4: 204
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313800_996313805 10 Left 996313800 5:122138304-122138326 CCTCACTGTCTAATTCCTTACCT 0: 1
1: 0
2: 0
3: 19
4: 238
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313797_996313805 18 Left 996313797 5:122138296-122138318 CCCTTTTCCCTCACTGTCTAATT 0: 1
1: 0
2: 5
3: 46
4: 454
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182
996313798_996313805 17 Left 996313798 5:122138297-122138319 CCTTTTCCCTCACTGTCTAATTC 0: 1
1: 0
2: 1
3: 44
4: 421
Right 996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG 0: 1
1: 0
2: 3
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996313805 Original CRISPR ATGCAAACCCACAATAAGAG GGG Intronic
902169087 1:14596402-14596424 ATGCAAATACACAAATAGAGAGG - Intergenic
902452792 1:16508611-16508633 ACCCAAACCCACAGGAAGAGGGG - Intergenic
902472852 1:16661282-16661304 ACCCAAACCCACAGGAAGAGGGG - Intergenic
902485951 1:16746161-16746183 ACCCAAACCCACAGGAAGAGGGG + Intronic
902499693 1:16901612-16901634 ACCCAAACCCACAGGAAGAGGGG + Intronic
903049696 1:20591361-20591383 AAACAAACCCACAATAAAGGAGG + Intronic
906051265 1:42875737-42875759 AGGTAACCACACAATAAGAGTGG - Intergenic
909767609 1:79376741-79376763 TTGCAAACACGCAATAATAGAGG - Intergenic
914004849 1:143723515-143723537 ACCCAAACCCACAGGAAGAGGGG - Intergenic
914097205 1:144554137-144554159 ACCCAAACCCACAGGAAGAGGGG - Intergenic
914301787 1:146383472-146383494 ACCCAAACCCACAGGAAGAGGGG + Intergenic
916175333 1:162033412-162033434 AAGCAAACCCCCAAAAAGGGTGG - Intergenic
917515224 1:175701508-175701530 ATGCACCCCTACAACAAGAGGGG + Intronic
917820984 1:178764075-178764097 AGACAAACACACAATAATAGTGG - Intronic
918271020 1:182899463-182899485 AAGGAAATCCAAAATAAGAGAGG - Intergenic
918443908 1:184597126-184597148 TTTCAAACCTGCAATAAGAGAGG + Intronic
918974146 1:191459767-191459789 ATTCAAATTCACAATAAGAAGGG - Intergenic
919083766 1:192896001-192896023 TTACAAACCCACAATATGAAAGG + Intergenic
921029490 1:211325292-211325314 ATACACACCCACAAAAAGAGAGG + Intergenic
922355407 1:224770482-224770504 ATGTAAACACAAAATTAGAGTGG - Intergenic
924292578 1:242552875-242552897 ATGAAAATCCACTATCAGAGTGG - Intergenic
1063101399 10:2952947-2952969 AGGCATCCCCACAAGAAGAGGGG + Intergenic
1069700725 10:70423284-70423306 ATGCACACCCAAAACTAGAGGGG - Exonic
1070303584 10:75223849-75223871 ATGAAAACCCACAAGGACAGAGG + Intronic
1071031554 10:81190006-81190028 TGGCAAATTCACAATAAGAGTGG + Intergenic
1072287106 10:93926690-93926712 ATGCAAACCCAGAACAAGCCAGG + Intronic
1072928286 10:99636581-99636603 ATGCAAACCCAGCAGAAGAAAGG + Intergenic
1073086761 10:100895997-100896019 ATGAAAACCCAATAAAAGAGAGG - Intergenic
1075853998 10:125612580-125612602 CTGCAAACTCACAAAAAGACTGG - Intronic
1077710039 11:4527014-4527036 GTGCCAACTCACATTAAGAGTGG - Intergenic
1078770077 11:14341069-14341091 ACGCAAAGCCACCAAAAGAGTGG + Intronic
1079275059 11:19027958-19027980 ATGCAAGGCCAAAATGAGAGAGG - Intergenic
1079801280 11:24872544-24872566 ATGAAAACACACAGGAAGAGAGG - Intronic
1079868543 11:25765557-25765579 GTGCAGACCCACACTAAGGGTGG + Intergenic
1081106358 11:39074905-39074927 ATGCCCACCCACACTGAGAGTGG - Intergenic
1081419437 11:42856096-42856118 TTGCAAATCAACAAAAAGAGAGG + Intergenic
1082938474 11:58678837-58678859 ATACAGACCCACAATAATAATGG - Intronic
1084079514 11:66812162-66812184 ATGCAAACTCAGAATAAGAGGGG - Intronic
1085844425 11:80049354-80049376 ATGGAGAGCCACAAAAAGAGGGG - Intergenic
1088151472 11:106750318-106750340 ATGCTAACCCACACTGAGGGTGG + Intronic
1090026124 11:123168996-123169018 ATGAAAGACCACCATAAGAGAGG + Intronic
1090221298 11:125029146-125029168 GTGCCAACCCAGAGTAAGAGTGG + Intronic
1090570472 11:128039227-128039249 ATGCTAACCCTCTGTAAGAGTGG - Intergenic
1092232867 12:6786684-6786706 AAGAAAACCCAAAATAATAGAGG - Intergenic
1093943927 12:25085918-25085940 ATGCAAACCCACAAATACAGAGG + Intronic
1097419131 12:59352245-59352267 ATGCAAACCCACACTCATACTGG + Intergenic
1099463642 12:82955399-82955421 AGTCAAACCCACAATAACAGTGG - Intronic
1100415380 12:94367418-94367440 ATACAAAACCAAAATGAGAGAGG + Intronic
1100978453 12:100145726-100145748 ATGCAAACCCCTAATAGGACAGG + Intergenic
1104290316 12:127460388-127460410 AAGCAAACCCTGAATGAGAGAGG + Intergenic
1104330059 12:127836326-127836348 ATGCAAACACACAATGAGTGAGG + Intergenic
1105997011 13:25682244-25682266 AGGGAAACCCACAATAAGAGTGG - Intronic
1108633154 13:52306391-52306413 AGGCAAACCCACCATCAGATTGG - Intergenic
1108653537 13:52506169-52506191 AGGCAAACCCACCATCAGATTGG + Intergenic
1109232942 13:59781407-59781429 TTGCAAAACCAAAACAAGAGGGG + Intronic
1109317995 13:60774657-60774679 AGGCAATCACACAATAATAGTGG - Intergenic
1109698136 13:65988444-65988466 GTGCCCACCCACAATAAGGGTGG + Intergenic
1110228594 13:73145015-73145037 ATGCAAAACCACAGAAACAGAGG - Intergenic
1111975698 13:94965069-94965091 ATATAAACCCACAATGAGAGTGG - Intergenic
1112114026 13:96333494-96333516 CTGCAGACCCCCAAAAAGAGAGG - Intronic
1112125333 13:96460228-96460250 AAGCAAACCCAGAATCAGACAGG + Intronic
1112253993 13:97811638-97811660 AGACAATCACACAATAAGAGTGG + Intergenic
1113032221 13:106006789-106006811 ATGAAAATCCACAATACGACAGG + Intergenic
1116217605 14:42039287-42039309 ATGCCCACCCAGATTAAGAGTGG + Intergenic
1120263348 14:82217043-82217065 CTGCAAACCCCCAATGACAGTGG + Intergenic
1121674893 14:95744546-95744568 TTGCAAAGCCACAAGATGAGAGG - Intergenic
1122992629 14:105244680-105244702 CTTCAAAACCACAATAATAGGGG + Intronic
1124855090 15:33380061-33380083 ATGCCCACCCACATTGAGAGTGG + Intronic
1125815342 15:42579265-42579287 ATGCACACCCAAAACTAGAGGGG + Intronic
1125888600 15:43248933-43248955 ATGCAAACCAATCATAAGTGAGG + Intronic
1126283214 15:46980616-46980638 ATGCCCACCCAGATTAAGAGTGG - Intergenic
1126321627 15:47430356-47430378 AGGCAAACCCACATCAAGAAAGG - Intronic
1126369380 15:47929445-47929467 ATGCAAACACACAGGAAGACAGG - Intergenic
1128704234 15:69827094-69827116 ATTCCAACCAACAATAACAGCGG + Intergenic
1130401407 15:83558084-83558106 ATGCAAATCCACAGTAAGGGAGG - Intronic
1138778813 16:59757425-59757447 AGGCAAAACCAGAAAAAGAGAGG - Intergenic
1140619658 16:76714172-76714194 ATGGAAACCCTCAATAAAATAGG - Intergenic
1141351539 16:83302768-83302790 AAGCCCAGCCACAATAAGAGTGG + Intronic
1146987753 17:37237524-37237546 AACCAAAACCACAATGAGAGTGG - Intronic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1149033140 17:52105750-52105772 ATGCTAATCCACAATAAGGAAGG - Intronic
1149194655 17:54104775-54104797 AGGCAACCACACAATAATAGTGG + Intergenic
1151282870 17:73089568-73089590 AGGCAAAGCCACACTGAGAGAGG - Intronic
1151624654 17:75269252-75269274 ATGCAAACCCCCAACAAGAGAGG + Intronic
1155741069 18:29288495-29288517 ATGCTAATCAAGAATAAGAGAGG + Intergenic
1156025066 18:32644419-32644441 AGGTAAACCCACAATTACAGCGG - Intergenic
1156763513 18:40622780-40622802 ATACAAACACACATAAAGAGAGG + Intergenic
1157847953 18:51021207-51021229 ATGCAAAGCCACAGAAACAGAGG - Intronic
1159452237 18:68617388-68617410 TTGAAAACTCACATTAAGAGAGG - Intergenic
1159735904 18:72097739-72097761 AGACAAACACACAATAATAGTGG - Intergenic
1159740440 18:72161743-72161765 ATACAAATCCACAATAAAATAGG - Intergenic
1162673210 19:12276207-12276229 GTGCAGACACAGAATAAGAGTGG - Intronic
1165320368 19:35081054-35081076 ATGCAACCCCACAAAATGGGCGG - Intergenic
1165637708 19:37356493-37356515 AAGAAAACCCACAAGAAGATAGG - Intronic
1165756638 19:38297124-38297146 ATGCAAACACACAACCTGAGGGG - Intronic
1165977827 19:39692659-39692681 CTCCAGACCCACAATAAGAAGGG - Intergenic
925490014 2:4380982-4381004 ATGCAAACCGATTATATGAGCGG - Intergenic
937809694 2:126185734-126185756 ATGCAGTACCACAATAATAGAGG - Intergenic
940025582 2:149203888-149203910 CAGTATACCCACAATAAGAGAGG + Intronic
941409482 2:165136198-165136220 ATGGAAACACAGGATAAGAGAGG - Intronic
942555454 2:177168265-177168287 CTGAAAACCCAAAATAACAGTGG + Intergenic
942832989 2:180258675-180258697 ATGCAAACCCAAAATCCTAGAGG + Intergenic
945514766 2:210749380-210749402 CTGCAATCCAACCATAAGAGTGG - Intergenic
947103492 2:226646064-226646086 ATACAAACTCACAAAATGAGAGG - Intergenic
949073749 2:242041968-242041990 CTGAGAACCCACAATATGAGAGG + Intergenic
1169286183 20:4309206-4309228 ATACAAACAAACAATAATAGGGG - Intergenic
1170510844 20:17075291-17075313 ATGCAAACCAGCAAGAGGAGAGG + Intergenic
1171116335 20:22527727-22527749 AAGAAAACCCACAATAAGTGGGG + Intergenic
1172018941 20:31899104-31899126 ATGGAAACCCAAAGTAAAAGAGG + Intronic
1173457807 20:43217428-43217450 AGGGAAACCCAAACTAAGAGAGG - Intergenic
1177268024 21:18809426-18809448 ATGCCAACCCAGATTAAGAGTGG - Intergenic
1182902359 22:33909053-33909075 GAACAAACCCCCAATAAGAGAGG + Intronic
949691415 3:6644161-6644183 AAGCAAAACCACAATAAGAATGG + Intergenic
952066284 3:29575706-29575728 TTGAAAACACACAATCAGAGGGG - Intronic
952817003 3:37454245-37454267 ATGCAAATCCACAGTGACAGTGG - Intronic
957605792 3:82397381-82397403 ATGCAAAAGCACAAAAAAAGGGG + Intergenic
958587571 3:96109660-96109682 ATGCACACACACAAATAGAGTGG - Intergenic
958817773 3:98935178-98935200 AGACAAACACACAATAATAGTGG + Intergenic
958865973 3:99502083-99502105 ATGCAAACCAACAATAAAACTGG - Intergenic
959761287 3:109968743-109968765 CTGCAAGCCTACAATAAAAGAGG + Intergenic
960548814 3:118950017-118950039 ATGCAAACCCTCAATAAAGAGGG + Intronic
961693630 3:128688667-128688689 CTGAAGACCCACAATCAGAGAGG - Intergenic
969073555 4:4558969-4558991 AAGGAAACCCACAATTAAAGAGG + Intergenic
972327428 4:38030093-38030115 AAGAAAACCCACATTATGAGAGG - Intronic
975024052 4:69527947-69527969 ATGCCCACCCACATTAAGGGTGG - Intergenic
976244902 4:82997041-82997063 ATGCAAAGCCACACAAAGACAGG + Intronic
976353261 4:84084617-84084639 ATGTAAAGCCACAATAATGGAGG + Intergenic
978537187 4:109774823-109774845 ATGCAAACCCAGCAGAAGAAAGG - Intronic
979299435 4:119069711-119069733 ATGCAAATCCAGGAGAAGAGGGG + Intergenic
980523859 4:133963938-133963960 ATCCAAACCCACCAGAAGAAAGG + Intergenic
980689415 4:136275223-136275245 AAACAAAACCAAAATAAGAGTGG - Intergenic
980804805 4:137798077-137798099 AAGAAAACCCACACTAAGGGAGG - Intergenic
981506837 4:145510806-145510828 AGGCAAACCCACAATCCTAGTGG - Intronic
982601502 4:157456606-157456628 ATGCAAATCCACAAAAAGTTAGG - Intergenic
986425164 5:7624098-7624120 ATGCAAATGCACAATAGAAGTGG - Intronic
987244923 5:16039136-16039158 ATGAAAATGCACAATTAGAGTGG - Intergenic
987662035 5:20889798-20889820 CTGCCCACCCACATTAAGAGTGG + Intergenic
988761548 5:34315502-34315524 GTGCCCACCCACATTAAGAGTGG - Intergenic
989786998 5:45344616-45344638 ATGCAAATCCAAAATAAGCAGGG + Intronic
990005687 5:50941879-50941901 ATGAAAACCCTCAATAAAATTGG + Intergenic
990025091 5:51178407-51178429 ATGTCAACACACAATAAGGGAGG + Intergenic
993443331 5:87981443-87981465 ATACACACCCACATTAAAAGTGG + Intergenic
994615729 5:102101633-102101655 AGGCAAGCCTACAATAACAGAGG - Intergenic
996313805 5:122138337-122138359 ATGCAAACCCACAATAAGAGGGG + Intronic
996325672 5:122270170-122270192 ATCCAAACCCAGAAGAAGAAAGG + Intergenic
997156059 5:131559367-131559389 AGACAAACCCACAATCACAGTGG - Intronic
999678286 5:154029432-154029454 ATGCAAACCCATTATAATAATGG + Intronic
1000882351 5:166712993-166713015 ATTCAAACCCAAAAAAAGAAAGG + Intergenic
1002411802 5:179085075-179085097 ATGAAAACCCAAAATATGGGAGG + Intergenic
1003425076 6:5993794-5993816 CTGCAAACCCCCAACTAGAGTGG - Intergenic
1003521656 6:6863313-6863335 TTGCAACCCCAGAATAAGAAGGG - Intergenic
1005106973 6:22234143-22234165 ATTCAAACTCACAAAAAGAAAGG - Intergenic
1005709883 6:28493548-28493570 AGGCAAACTCACAAAAAGAAAGG - Intergenic
1005714776 6:28536249-28536271 ATGCTAACCCTCAATAAGAAGGG - Intergenic
1010277479 6:73986597-73986619 AAGCAAACCTACAATCAGCGGGG - Intergenic
1012903982 6:105042821-105042843 AAGAAAAACCACAATGAGAGGGG - Intronic
1015312050 6:131776932-131776954 AAGAAAACCCACAATAGGAAGGG - Intergenic
1017330074 6:153186942-153186964 AGACAAACCCAAAATAAGGGTGG + Intergenic
1018610238 6:165641569-165641591 ATGATAACCCACAGTCAGAGCGG + Intronic
1020533699 7:9366792-9366814 AGACAAACACACAATAATAGTGG + Intergenic
1023543458 7:41291970-41291992 AAGCAAAACCACAGCAAGAGGGG + Intergenic
1024091336 7:45943593-45943615 TGACAAACTCACAATAAGAGTGG - Intergenic
1027889772 7:83956938-83956960 ATACAAGCTCACAATAAGAGCGG - Exonic
1028276838 7:88867515-88867537 GTGCACACCCACATTAAGGGGGG + Intronic
1028380533 7:90194419-90194441 ATGCACACCAAAAATAAGGGAGG - Intronic
1029794851 7:102883016-102883038 ATGGAAACCCTCAATAGGAAAGG + Intronic
1030423363 7:109338609-109338631 AGGCCAACCCACAATATGGGTGG + Intergenic
1033754250 7:144384909-144384931 ATGGAAACCCAGAAGGAGAGAGG + Intergenic
1034430485 7:151038837-151038859 ATCCAAACCCCCAAGATGAGTGG - Intronic
1037305725 8:17501545-17501567 ATACACACCCAGAATAACAGGGG - Intronic
1040962498 8:53049288-53049310 ATACAAAAGAACAATAAGAGGGG - Intergenic
1041132563 8:54717036-54717058 CTGCCACCCCACAAGAAGAGAGG - Intergenic
1042088866 8:65136564-65136586 ATCCAAACCCAGCAGAAGAGAGG + Intergenic
1042485222 8:69339940-69339962 CTGAGAACCCACAATATGAGAGG + Intergenic
1047981216 8:130184647-130184669 ATGGAAACCCCAAATAACAGTGG - Intronic
1049937488 9:513540-513562 ATGCAAACCAACAAGACTAGAGG - Intronic
1051797026 9:20883289-20883311 AGACAAACCCACAATAATAATGG + Intronic
1054849298 9:69830085-69830107 AAGCAAACCCACAAAGAGAGAGG - Intronic
1055131761 9:72783532-72783554 ATGCCCACCCACATTAAGGGTGG + Intronic
1057318930 9:93994207-93994229 AGGCAAGACCATAATAAGAGAGG + Intergenic
1057464067 9:95295526-95295548 CATCAAAACCACAATAAGAGAGG + Intronic
1059627379 9:116081486-116081508 ATGCAAACAGACAAGAAAAGGGG + Intergenic
1060151892 9:121294248-121294270 ACGCAAATCCACAACAAGACAGG - Intronic
1061140902 9:128765885-128765907 ATGCAGACACACAATAATTGGGG + Intronic
1061172009 9:128963799-128963821 AAAAAAACCCACAATAAGACAGG - Intronic
1185487995 X:497806-497828 CTGCAAAACCACGATGAGAGAGG + Intergenic
1186549985 X:10493531-10493553 GTGCAAAACCTCAATTAGAGAGG + Intronic
1186854027 X:13608801-13608823 AAGCAAACCTAAAATAACAGTGG + Intronic
1189429377 X:40933341-40933363 CTCCTAACCCACAATAAGATTGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1192054253 X:67757288-67757310 ATGCACACACACAATAAAGGTGG - Intergenic
1193000429 X:76556856-76556878 ATGCAAACACACAAAGAGTGAGG + Intergenic
1194237498 X:91402228-91402250 ATGCAAACCCAGCAGAAGAAAGG + Intergenic
1194996525 X:100597108-100597130 ATGCAAACCTAAAATAAGGCAGG + Intronic
1197589157 X:128386906-128386928 ATGCAAACCCAGCAGAAGAAAGG + Intergenic
1198125577 X:133640460-133640482 ATGCAAATCCTCAACAAGAAAGG + Intronic
1199052590 X:143254171-143254193 GTGCCTACCCACATTAAGAGTGG - Intergenic
1202175371 Y:22094089-22094111 ATGCAACCCTTCAATAAAAGAGG + Intronic
1202215991 Y:22492294-22492316 ATGCAACCCTTCAATAAAAGAGG - Intronic