ID: 996314925

View in Genome Browser
Species Human (GRCh38)
Location 5:122150928-122150950
Sequence TATCCCACCAGGATGGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996314921_996314925 -5 Left 996314921 5:122150910-122150932 CCATGAAAGATCTGCAGATATCC 0: 1
1: 0
2: 1
3: 19
4: 343
Right 996314925 5:122150928-122150950 TATCCCACCAGGATGGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 91
996314920_996314925 23 Left 996314920 5:122150882-122150904 CCTCAAGCAGCATCTGTGTATCA 0: 1
1: 1
2: 1
3: 10
4: 168
Right 996314925 5:122150928-122150950 TATCCCACCAGGATGGGTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996314925 Original CRISPR TATCCCACCAGGATGGGTGC CGG Intronic
900120470 1:1046627-1046649 GACGCCACCAGGCTGGGTGCAGG - Exonic
900285839 1:1899897-1899919 CGTCTCACCAGGATGTGTGCAGG - Intergenic
902757415 1:18558180-18558202 TATACCACCAGGATGAATTCGGG + Intergenic
903035449 1:20489955-20489977 TATCCCACCAGCTTGAGTGTGGG - Intergenic
905003084 1:34688669-34688691 TATCCTCTCAGGCTGGGTGCTGG - Intergenic
908438076 1:64126481-64126503 TATCCCACCAAGATGGCTGCAGG - Intronic
912988501 1:114459159-114459181 AGACCCATCAGGATGGGTGCTGG + Intronic
914750626 1:150532576-150532598 TGTCCCACCAAGGCGGGTGCTGG - Intergenic
918116508 1:181502639-181502661 CATCCCTCCAGGAAGGGAGCTGG + Intronic
919798084 1:201333272-201333294 TGCCCCACCTGGATGGGTTCAGG - Intergenic
921856804 1:219995264-219995286 TAACCCAAAAGGATGGGTGATGG + Intronic
922572589 1:226642770-226642792 TCTCCCACCAGGACAGGTTCTGG - Intronic
923266490 1:232319418-232319440 AAGCCAACCAGGATGGCTGCCGG - Intergenic
1067538543 10:47135295-47135317 TAACTCAGCAGGTTGGGTGCTGG - Intergenic
1074325422 10:112446638-112446660 TGTCCCACCAGAGTGGGAGCAGG - Intronic
1078679871 11:13465313-13465335 TATCCTACTTGGATGGGTCCTGG + Intergenic
1083112527 11:60425364-60425386 TATCCCACTAGTAATGGTGCTGG - Intergenic
1091100206 11:132864940-132864962 TCTCCCACCAGCATGGCTTCAGG - Intronic
1091118959 11:133040796-133040818 AATACCACCAGGATGGGAGAAGG + Intronic
1103551151 12:121738434-121738456 AAGGCCACCAGGAGGGGTGCGGG + Intronic
1104148195 12:126055587-126055609 TGTCCCAGCAGGAAGGCTGCTGG - Intergenic
1104881601 12:132075178-132075200 TCTCCCTCCAGGATGGCAGCTGG + Intronic
1107449134 13:40492698-40492720 AATCTCAACAGCATGGGTGCCGG + Intergenic
1107566909 13:41614281-41614303 TATCTCACCATGAGGAGTGCTGG - Intronic
1111646026 13:91032898-91032920 TATCCCACCAGGTTGTGAGAAGG + Intergenic
1113143084 13:107176024-107176046 TGTCCCAGCAGGTTGTGTGCAGG - Intronic
1120818613 14:88890879-88890901 TCTCCCATCAGAATGGGTCCTGG + Intergenic
1122826488 14:104373301-104373323 AATCACACCAGGAGGGCTGCTGG - Intergenic
1123818287 15:24001280-24001302 TATCTTCCCAGGATGGGTGCAGG - Intergenic
1131426040 15:92346280-92346302 GATAGCACCAGGATGGGGGCTGG + Intergenic
1131729036 15:95259767-95259789 TATCCCACCAGCATGAGGTCAGG - Intergenic
1131850878 15:96542201-96542223 CAACCCAGCAGGATGGCTGCTGG - Intergenic
1135422349 16:22313759-22313781 CATCCCACCAGGATGAAGGCAGG - Intronic
1136634848 16:31514088-31514110 TCTGTCACCAGGCTGGGTGCAGG + Intergenic
1139358617 16:66382491-66382513 TATCCCACCGGGAAGGATGCAGG - Intronic
1140187667 16:72788993-72789015 TATCCCACCAGGCTCAGGGCTGG + Intronic
1140187683 16:72789094-72789116 TATCCCACCAGGCTCAGAGCTGG + Intronic
1140187701 16:72789195-72789217 TATCCCACCAGGCTCAGGGCTGG + Intronic
1141300851 16:82814321-82814343 GATACCCCCAGGATGGGTGCTGG + Intronic
1146608523 17:34284418-34284440 TAACCCACCAGGAATGGAGCAGG + Intergenic
1146694212 17:34896602-34896624 TAGCACAGCAGGATGGGTGCAGG + Intergenic
1147262469 17:39216762-39216784 CATCCCACCACAATGGGAGCAGG + Intronic
1152296647 17:79471169-79471191 TCTTCCAGCAGGAGGGGTGCTGG - Intronic
1152484023 17:80577782-80577804 TCTCCCTCCAGGAAGGCTGCAGG - Intronic
1153068792 18:1080307-1080329 AATCCCACAAGTATGGGGGCTGG - Intergenic
1155439031 18:25842260-25842282 CATCCCAGGAGGATGGATGCTGG - Intergenic
1158914109 18:62102891-62102913 TTTCAAAACAGGATGGGTGCAGG - Exonic
1159112834 18:64079676-64079698 TAGGCCACCATGATGGGTGAGGG - Intergenic
1159930575 18:74309212-74309234 TAACCCACCAGCATGTCTGCTGG + Intergenic
1166937809 19:46345488-46345510 TAACCCACCAAGATGGGCTCTGG + Intergenic
1168650104 19:58087177-58087199 GCTCCCACCAGGGTGGGTTCTGG + Intronic
925912209 2:8581358-8581380 TGTCTCACCAGCCTGGGTGCTGG - Intergenic
927275260 2:21257035-21257057 TAGGGCACCAGGTTGGGTGCTGG - Intergenic
928872221 2:35993200-35993222 TGTCCCTCCTGGATGGGAGCAGG + Intergenic
930711983 2:54558255-54558277 TATACCACGAGGAGGGGCGCGGG - Intronic
930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG + Intergenic
932316792 2:70790159-70790181 TAACCCTCCAGGATTTGTGCAGG - Intronic
933705995 2:85290885-85290907 CAGCCCACCAGGATGGGAGCTGG + Intronic
948783242 2:240337596-240337618 AAAACAACCAGGATGGGTGCAGG - Intergenic
1169240082 20:3969716-3969738 TATCCCAGCAAGATGGCTGGGGG - Intronic
1170906091 20:20516241-20516263 TAAGCTACCAGGGTGGGTGCAGG - Intronic
1174840726 20:53899193-53899215 TGTGCCACCATGATGGGTACTGG - Intergenic
1176132697 20:63502962-63502984 CTCCCCACCAGGGTGGGTGCTGG - Intergenic
1176426188 21:6549908-6549930 GCTCTCACCAGGATGGGTGGGGG - Intergenic
1177322760 21:19544058-19544080 TATAGCCTCAGGATGGGTGCTGG + Intergenic
1179519274 21:41931767-41931789 GATAGCACCAGGATGGGGGCTGG + Intronic
1179701679 21:43158225-43158247 GCTCTCACCAGGATGGGTGGGGG - Intergenic
1181598400 22:23933801-23933823 TGACCCACCAGGTTGGGGGCTGG - Intergenic
1182144966 22:27991995-27992017 CAGCCCACCAGGATGGCTGCAGG - Intronic
1183407610 22:37638229-37638251 TTTCCCAACAGGAAGGCTGCTGG - Intronic
1184335828 22:43852541-43852563 GTTCCCACCTGGATGGGGGCAGG - Intronic
1185128715 22:49025672-49025694 TATCCCAGAAGGATGGGAGCCGG - Intergenic
950041143 3:9920229-9920251 TAGCACAGCAGGGTGGGTGCAGG + Intronic
951055819 3:18145379-18145401 TCTCCCACCATGCTGGTTGCTGG + Intronic
954405895 3:50344931-50344953 TGGCACACCAGGCTGGGTGCAGG - Intronic
954517372 3:51190769-51190791 TATGCTACCAGGGTGGGTGGAGG + Intronic
959889780 3:111541551-111541573 TCTCCCACCAGGTTGGCTGGAGG - Intronic
962712539 3:138100086-138100108 AATCCCCCCAGGATGGGGGTTGG + Intronic
969370701 4:6729278-6729300 CAGCCCAGCAGGGTGGGTGCGGG + Intergenic
973202381 4:47519239-47519261 GATTCCACTAGGATGGGAGCTGG - Intronic
974560803 4:63514713-63514735 TATCCCGCCAAGATAGGTTCTGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
982478150 4:155877768-155877790 TACCCCACCCTGATGGCTGCAGG - Intronic
989380097 5:40802081-40802103 TATCTCTCCTGGATGGGTGGGGG - Intergenic
996314925 5:122150928-122150950 TATCCCACCAGGATGGGTGCCGG + Intronic
999937296 5:156501178-156501200 TCTCCCACTGGGATGGGTGGGGG - Intronic
1008738918 6:54581125-54581147 TATCACCCCAGCATGGGTGATGG - Intergenic
1019366421 7:635664-635686 TCTCCCTCCATGATGGCTGCAGG + Intronic
1019713674 7:2528913-2528935 CAGCCCACCAGCATGGCTGCTGG - Intronic
1020121986 7:5509763-5509785 TGCCCCACCAGGTTGGGTGCTGG - Intronic
1021891248 7:25188224-25188246 CATCTCACCAGGAGAGGTGCTGG + Intergenic
1023312561 7:38902727-38902749 CATTCCATCAGGATGAGTGCAGG - Intronic
1026852598 7:73734600-73734622 TAACCCTTCAGGATGGGGGCTGG + Intergenic
1029542927 7:101195149-101195171 TAGCACATCAGGATGGGGGCAGG + Exonic
1045140650 8:99278615-99278637 TTTCCCACCATGTTGGGTGTTGG + Intronic
1048131808 8:131705977-131705999 TAGCCCAGCACGATGGGGGCTGG + Intergenic
1048727051 8:137398437-137398459 TATCCCAGCAGGTTAGGTCCTGG + Intergenic
1057040555 9:91844661-91844683 CATCCCGCCAGTATGGGGGCTGG - Intronic
1060294454 9:122333760-122333782 TAGCCCACTAGGATGGGTTGGGG - Intergenic
1061699162 9:132402228-132402250 AATCCCACCAGGAGGAGTCCTGG - Exonic
1198795532 X:140390461-140390483 TATCCCACCATTTTGGGGGCAGG - Intergenic