ID: 996316701

View in Genome Browser
Species Human (GRCh38)
Location 5:122168465-122168487
Sequence CTTTGTGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996316694_996316701 26 Left 996316694 5:122168416-122168438 CCAAGATGGTTTAGTGTATAAAA 0: 1
1: 0
2: 2
3: 15
4: 196
Right 996316701 5:122168465-122168487 CTTTGTGAGGCCAAGGTGGATGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
996316695_996316701 -8 Left 996316695 5:122168450-122168472 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 996316701 5:122168465-122168487 CTTTGTGAGGCCAAGGTGGATGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996316701 Original CRISPR CTTTGTGAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr