ID: 996330496

View in Genome Browser
Species Human (GRCh38)
Location 5:122323131-122323153
Sequence GGCGCTGTTGCCCGAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996330496 Original CRISPR GGCGCTGTTGCCCGAGTTCA TGG (reversed) Intronic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
900820152 1:4880323-4880345 GGTGCTGTTGCCACAGCTCATGG - Intergenic
904259414 1:29279868-29279890 GGGGCTGGTGCCTGAGGTCAGGG + Intronic
904862779 1:33551412-33551434 GGAGCTGTTGCAGTAGTTCAAGG + Intronic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
914950349 1:152108569-152108591 GCCGCTGTTGCCCGCGCTCCTGG + Exonic
1063912669 10:10848340-10848362 GGCGCTGTTGCCATTTTTCAAGG - Intergenic
1070770899 10:79081790-79081812 GGGGCTGTCGCACGAGTCCAAGG + Intronic
1073425063 10:103451300-103451322 TTCGCTGTTGCCCGAGGCCATGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1084707330 11:70823000-70823022 GGTGATGTTGGCAGAGTTCATGG + Intronic
1084712604 11:70853200-70853222 GGCTCTGTTTCCAGAGCTCACGG - Intronic
1091551056 12:1535091-1535113 GGGGCTGGTGCCTGAGTTCTAGG + Intronic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1103544064 12:121687234-121687256 GGCGCTGGTGGCCGAGTTTGGGG + Intergenic
1107586178 13:41850541-41850563 GGCTCTGAAGCCTGAGTTCATGG - Intronic
1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG + Intergenic
1114060671 14:19013766-19013788 GGCGCTGTAGCCCAACTTTAGGG + Intergenic
1114101584 14:19386212-19386234 GGCGCTGTAGCCCAACTTTAGGG - Intergenic
1122368928 14:101216887-101216909 GGGGGTGTTGCAAGAGTTCATGG - Intergenic
1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG + Intergenic
1128240102 15:66095913-66095935 GGAGCTGTTCCCCGGGGTCAAGG - Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1134011937 16:10860276-10860298 GGCTCTATTTCCCCAGTTCACGG - Intergenic
1137562026 16:49508996-49509018 GGAGCTGTTGCCTTATTTCACGG - Intronic
1139205841 16:65027599-65027621 GTCCTTGTTGCCCAAGTTCATGG - Intronic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG + Intronic
1143614244 17:8039927-8039949 GGCGCTGTTGCTGGAGCACAGGG - Exonic
1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG + Intronic
1157886463 18:51371438-51371460 GGAGCTGTTGCACAAATTCAGGG + Intergenic
1160706359 19:531964-531986 GGCGCTGCTGCTGGAGCTCAAGG + Exonic
1168364890 19:55777767-55777789 GGCGCTGGTGTCCAAGATCAAGG + Intergenic
931379132 2:61735938-61735960 GGTGCTGAGGCCAGAGTTCAGGG - Intergenic
932484875 2:72078668-72078690 GGTGCTGTTGCCAGATTGCAAGG - Intergenic
939007895 2:136810166-136810188 CGTGCTGCTGCCTGAGTTCATGG + Intronic
941191768 2:162393101-162393123 GGAGTTGTTGCCAGAGTTGATGG + Intronic
942650096 2:178157588-178157610 AGCCCTGTTGCCCCAATTCAAGG + Intergenic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
944531290 2:200670169-200670191 GGCGCTGTTGCCAGAGGGGAGGG - Intronic
947235698 2:227938565-227938587 AGGGCTGTGGCCCAAGTTCACGG + Intergenic
1169481488 20:5986047-5986069 GGCTCTGTTTCCGGAGCTCAAGG - Exonic
1174302807 20:49594620-49594642 AGCCCTGTTGCCCAAGCTCAGGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1176298098 21:5085064-5085086 GGCGCTGTTCCCCCAGCACAGGG - Intergenic
1178998881 21:37435326-37435348 GCCGCTGTTGCTGGGGTTCAGGG + Intronic
1179858931 21:44176885-44176907 GGCGCTGTTCCCCCAGCACAGGG + Intergenic
1180479154 22:15736378-15736400 GGCGCTGTAGCCCAACTTTAGGG + Intergenic
1180731443 22:17985344-17985366 GGCTCTGTTCTCAGAGTTCACGG - Intronic
1180793752 22:18591904-18591926 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181227988 22:21403416-21403438 GAGGCTGTTGCCCCAGCTCAGGG + Intergenic
1181250665 22:21531423-21531445 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1184659161 22:45957957-45957979 TGGGCTGTTGCCCGCATTCAGGG - Intronic
954315047 3:49796561-49796583 GGCGTTGTCACCTGAGTTCAGGG - Intronic
959250620 3:103938621-103938643 AGTGCTGTTGTCCTAGTTCAGGG - Intergenic
961214202 3:125147148-125147170 GGCGCTGTTGTCCTAGTCCTAGG + Intronic
968292809 3:197552052-197552074 TGCGCAGTTGTCTGAGTTCAGGG - Intronic
969115688 4:4869437-4869459 GGCGCTGCTGCCAGAGTTTGCGG + Intergenic
979923509 4:126530120-126530142 GGCCCTGTTTCCTCAGTTCAGGG - Intergenic
980920744 4:139083690-139083712 GCCGCTGCTGCCCGCGTTCGGGG - Intronic
985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1007711665 6:43828120-43828142 GGCGTGGTTTCCCGAGTTGATGG - Intergenic
1007909613 6:45500644-45500666 GGCGCTGTTGCCAGGGTGAATGG + Intronic
1014032333 6:116719816-116719838 TGCTCTGTTGCCCAAGCTCAAGG - Intronic
1026942157 7:74293430-74293452 GGGGCTGTAGCCTGAGTCCACGG + Intronic
1026955892 7:74376302-74376324 GGCGCCTGGGCCCGAGTTCAGGG - Exonic
1029223689 7:99009514-99009536 GCCTCTGTTGACAGAGTTCATGG + Intronic
1035534634 8:381751-381773 GACGCTGTTCCCGGTGTTCAGGG - Intergenic
1048996929 8:139800296-139800318 GGCCCTGTTGGCTGAGTTCTTGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG + Intronic
1060662743 9:125414019-125414041 GGGGCTGTTGCCCATGTGCAGGG + Intergenic
1062345942 9:136115351-136115373 GGCGCAGATGCCTGTGTTCAGGG - Exonic
1186575103 X:10757066-10757088 GAGGCTGATGCCCAAGTTCAAGG - Intronic
1193923836 X:87462260-87462282 GGCACTGTTGCCCGTGTTGGTGG - Intergenic