ID: 996332184

View in Genome Browser
Species Human (GRCh38)
Location 5:122342319-122342341
Sequence CCCTGGGAGCAGTGACTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996332184_996332189 -8 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332189 5:122342334-122342356 TCCCAGGGCACGGGTCCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 164
996332184_996332194 19 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332194 5:122342361-122342383 TCCACAGGAATTACCACTGCAGG No data
996332184_996332198 29 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332198 5:122342371-122342393 TTACCACTGCAGGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 205
996332184_996332196 27 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332196 5:122342369-122342391 AATTACCACTGCAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 152
996332184_996332188 -9 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332188 5:122342333-122342355 CTCCCAGGGCACGGGTCCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 229
996332184_996332197 28 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332197 5:122342370-122342392 ATTACCACTGCAGGCTTCCTGGG No data
996332184_996332192 4 Left 996332184 5:122342319-122342341 CCATGGAGTCACTGCTCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 255
Right 996332192 5:122342346-122342368 GGTCCTCAGGGAATGTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996332184 Original CRISPR CCCTGGGAGCAGTGACTCCA TGG (reversed) Intronic
900346412 1:2212534-2212556 CCCAGGCAGCAGTACCTCCAAGG + Intronic
900484246 1:2914000-2914022 CCCTAGAATCACTGACTCCACGG - Intergenic
900518524 1:3094784-3094806 CCCTGGCTGCAGGGAGTCCAGGG - Intronic
900636625 1:3669227-3669249 CCGTGGGTGCAGTGGCTCCGGGG + Intronic
900671173 1:3855947-3855969 CCCAGGCAGCGATGACTCCATGG + Intronic
901003742 1:6161621-6161643 GCTTGGGAGCCGTGGCTCCAGGG - Intronic
901440623 1:9275872-9275894 CACTAGGAGCAGCTACTCCAGGG + Intergenic
902037871 1:13470712-13470734 CCCAGGGAGCAAGGAGTCCATGG - Intergenic
902818268 1:18928249-18928271 CCTTGGGATCAGGGGCTCCATGG - Intronic
902820450 1:18940016-18940038 CCCTGAGGGGAGAGACTCCAAGG - Intronic
902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG + Intergenic
904817592 1:33217108-33217130 CCCAGGGAGCAATGACTTCCTGG + Intergenic
904874384 1:33643035-33643057 TCCTGGGAGCTGTGGCTTCAGGG - Intronic
905017268 1:34786271-34786293 CCCTGGGAGCAGGGTCTGAAAGG - Exonic
905142409 1:35858588-35858610 CCCTGGTAGCTGGGACTACAGGG + Intergenic
907076831 1:51586753-51586775 CCCTGGGACCAGCCACCCCAAGG - Intronic
908153033 1:61324196-61324218 CCCTGAGAGCAGTGTCCCCAGGG + Intronic
908791641 1:67788456-67788478 CCCTGGTAGCTGGGACTACAGGG + Intronic
910765152 1:90774830-90774852 CTCTGTGAGCATTGACTGCAAGG - Intergenic
912543797 1:110436598-110436620 AGCTGGGAGCATTGACTCCTGGG + Intergenic
912692642 1:111815934-111815956 CACTGCCAGCAGTGACTCCTAGG + Intronic
912964516 1:114226339-114226361 TCCTGGGCTCAGTGACTGCACGG - Intergenic
915121062 1:153629741-153629763 CCCTGGGAACTCTGGCTCCAAGG + Intronic
916265925 1:162889803-162889825 CAGTGGGGGCAGTAACTCCAGGG - Intergenic
920292488 1:204933512-204933534 CCATGGGATCAGTGTCACCATGG + Intronic
922695564 1:227729257-227729279 CCCTGGAGGCAGGAACTCCAGGG - Intronic
923015948 1:230126827-230126849 CGCTGGGTGCAGTCACTCCTTGG - Intronic
1063208100 10:3854096-3854118 CCCTGGGAGAACAGACTGCAAGG - Intergenic
1063899094 10:10713321-10713343 CCTTGTCAGCAGTGACTCTACGG + Intergenic
1064251625 10:13710514-13710536 GCCTGGGAGCCGGGACTCCATGG - Intronic
1064442768 10:15369721-15369743 GCCTGGGAGCAGAGACGCCCGGG - Intronic
1065892679 10:30134598-30134620 CCCTGGGTGCAGTGAGGACAGGG + Intergenic
1067169189 10:43892214-43892236 TCCTGGGATGGGTGACTCCATGG + Intergenic
1067655450 10:48188256-48188278 CCCTTGGAGCTGTGACACCAGGG + Intronic
1067837849 10:49652589-49652611 CACTGGAAGCAGTGACCCTAGGG - Intronic
1068801160 10:61141574-61141596 CCCTAGGAGCTGGGACTACAAGG + Intergenic
1069627406 10:69876824-69876846 CCCTGGGAGCAGGGACTTTGGGG - Intronic
1069950860 10:72017190-72017212 CCCGGGGTGGAGTGAGTCCAAGG - Intergenic
1070327182 10:75396704-75396726 CTCTCAGAGCTGTGACTCCACGG + Intergenic
1073074174 10:100813174-100813196 CTGTGGGTGCAGTGGCTCCAGGG - Intronic
1073548210 10:104371607-104371629 CCCAGGCAGCTCTGACTCCAGGG - Intronic
1074559235 10:114520198-114520220 GGCTTGGAGCTGTGACTCCATGG - Intronic
1075286706 10:121193334-121193356 CCCTGGTTGCATTGACTGCATGG - Intergenic
1075427063 10:122350194-122350216 CCCAGTGAGGAGAGACTCCATGG + Intergenic
1076063599 10:127431207-127431229 TCCTGGGAGGTGGGACTCCACGG - Intronic
1076477481 10:130762625-130762647 CCCGGGCTGCAGTAACTCCATGG - Intergenic
1076683787 10:132187693-132187715 ACCTGGGTTCAGCGACTCCAAGG + Intronic
1077253005 11:1568881-1568903 CCCTGGGAGCTGTAGGTCCAGGG - Intronic
1078019360 11:7642394-7642416 CTCTAGGACCAGGGACTCCAAGG + Exonic
1078396031 11:10982959-10982981 CTCTGGCAGAAGTGCCTCCAAGG - Intergenic
1078483882 11:11704352-11704374 CCCTGGGAGCTGCCACTCCTTGG + Intergenic
1079237068 11:18698716-18698738 CCCTGGCAGCGGTGACGTCACGG + Intronic
1081566802 11:44265356-44265378 CCCTGGGAACAGAGATGCCAAGG - Intronic
1081692432 11:45087476-45087498 AGCAGGGAGCAGTGTCTCCAGGG - Intergenic
1082797827 11:57390683-57390705 CCCTGGGGGAAGTTCCTCCAAGG - Intronic
1083768911 11:64855533-64855555 CCCCGAGAGCAGAGCCTCCAAGG + Intronic
1084270848 11:68028301-68028323 CCTTGGATGCAGTGATTCCATGG - Exonic
1084793720 11:71490757-71490779 CCCTGGAAGAAGCGACTCCCTGG + Intronic
1086404326 11:86487123-86487145 CCCTGGGAGCAGTGAGGGGAGGG - Intronic
1087396625 11:97609186-97609208 CACTGGGAGGCCTGACTCCAGGG - Intergenic
1092167695 12:6352978-6353000 CCCTGGGAGGAGGAACTGCAGGG + Intronic
1095850302 12:46796627-46796649 CTCTAGGAGCAGTTACTCCGGGG + Intronic
1096275613 12:50205200-50205222 CCCAAGTAGCAGTGACTTCAAGG + Intronic
1096840959 12:54379075-54379097 CCCTGGGGGCCGCGGCTCCATGG + Intronic
1099652577 12:85447068-85447090 CCCTGTGAGAAGTCAATCCAAGG - Intergenic
1100768996 12:97900555-97900577 CACTGGTAGCAGTAACTCGAGGG - Intergenic
1102871651 12:116418712-116418734 CCCTGGCAGCTGGGCCTCCAGGG + Intergenic
1103361070 12:120354107-120354129 CCCTAGTAGCTGTGACTACAAGG + Intronic
1103601379 12:122056862-122056884 CCCTGGGAGCAGGGATCGCAGGG - Intronic
1105001928 12:132695665-132695687 CGCTGGGAGCAGAGAGTCAACGG + Intronic
1105279536 13:18955211-18955233 CCATGGGCTCAGTGCCTCCATGG + Intergenic
1105813997 13:24016842-24016864 CCCAGGGTGCAGAGAATCCAGGG + Intronic
1105840297 13:24248208-24248230 CCCTGGGAATGGTTACTCCATGG + Intronic
1106110186 13:26770428-26770450 TTTTGTGAGCAGTGACTCCAAGG - Intergenic
1107411181 13:40160136-40160158 GGCTGTGAGCAGTGAATCCAGGG - Intergenic
1111228543 13:85309245-85309267 TCATGGGAGCAGTTACTCTATGG + Intergenic
1114522724 14:23349008-23349030 CCCTGATAGCAGTAAGTCCAGGG - Intronic
1116419093 14:44712669-44712691 CTCTGGCAGCAGTGCCTACAAGG + Intergenic
1117487286 14:56211188-56211210 CACTGGCAGCATTGACTCAAGGG - Intronic
1117841584 14:59866316-59866338 CCCTGGGAGCATGGATTGCAAGG - Intronic
1118323456 14:64766675-64766697 CTCTGGCTGCAGTGACTCCCAGG + Intronic
1119390291 14:74287059-74287081 CCCTGGGACCACTCAATCCAGGG + Intronic
1119480464 14:74955060-74955082 TCCAGGGAGCAGCAACTCCAAGG - Intronic
1121635340 14:95450193-95450215 CCCTGGGAGCAGTGCATGCTGGG - Intronic
1122563095 14:102631143-102631165 CACTGTGAGAAGTGACTGCATGG + Intronic
1122626487 14:103087848-103087870 TCCTGAGAGCTGTGACCCCAGGG + Intergenic
1122770569 14:104095879-104095901 CCCTGGGAGCTGTGAGGCCCTGG + Intronic
1124503622 15:30252669-30252691 GGCTGAGAGCAGTGACTCCTAGG - Intergenic
1124715218 15:32053696-32053718 ACCTGGGAGCTGTGACTCCAAGG - Intronic
1124739933 15:32285969-32285991 GGCTGAGAGCAGTGACTCCTAGG + Intergenic
1131096119 15:89655284-89655306 CCCTGGGAGCCGGCACTCCTGGG - Intronic
1131448423 15:92518816-92518838 TCCCGGGAGCAGTGACTCTTCGG + Intergenic
1132992756 16:2805534-2805556 CACTGGGAGCATTTCCTCCATGG - Intergenic
1133978498 16:10617203-10617225 CCCTGGGCCCAGTGACAGCAGGG + Intergenic
1134187572 16:12096837-12096859 TCCTGGGAGCAAGGAATCCAGGG - Intronic
1135040974 16:19116025-19116047 CCCTGGGTGCGCTGACTCCGGGG - Exonic
1137624596 16:49899851-49899873 CCCTGGGAGCACTGGGTCCTTGG + Intergenic
1137729207 16:50677487-50677509 CCCTGGGAGCCCTGGCTGCATGG - Exonic
1138945317 16:61842311-61842333 TCCTGGGAGCAGAGACCTCATGG - Intronic
1139957011 16:70697931-70697953 TCCTGGAGGCAGGGACTCCAGGG - Intronic
1140524208 16:75608797-75608819 TCAGGGGAGCAGTTACTCCAGGG + Intronic
1140894218 16:79310954-79310976 TCCTGGGAGCAGTGGAGCCAAGG - Intergenic
1141701531 16:85644526-85644548 CACTGGGAGCCGTGTCTTCACGG - Intronic
1142212756 16:88816267-88816289 CCCAGGCTGCAGTGGCTCCACGG - Intronic
1142271066 16:89089486-89089508 CCCCAGGAGCAGTGAGTCCCTGG + Intronic
1142665851 17:1463382-1463404 CCCTGGTAGCTCTGTCTCCAGGG + Intergenic
1143000882 17:3794450-3794472 CCCTGCCACCAGTGAGTCCAAGG + Intronic
1143388123 17:6544005-6544027 TGCTGGCAGCTGTGACTCCAGGG + Intronic
1143611776 17:8022104-8022126 CCCTGGGAGAGGTGACCCCAGGG - Intergenic
1144024968 17:11269535-11269557 CCCTGGGAACAGGGACTCTCTGG - Intronic
1144385041 17:14741490-14741512 CCCTGGGAGAAGGTATTCCAGGG - Intergenic
1146573127 17:33969712-33969734 TCCTGGGGGCAGGAACTCCAGGG + Intronic
1147135986 17:38434461-38434483 CCCTGGGAGGAGAGACAGCATGG + Intronic
1147605560 17:41772058-41772080 CCCTGGGAGCAGTGAGCCCCAGG + Intronic
1148444768 17:47730884-47730906 GACTGGCAGCAGTGACACCAGGG + Intergenic
1148965144 17:51428750-51428772 CTCTGGCAGCAAAGACTCCAAGG + Intergenic
1149042067 17:52202185-52202207 CCCTGGCAGCAATGCCTCCAAGG - Intergenic
1151367594 17:73627512-73627534 CCCAGGGAGCAGAGACCCCAAGG + Intronic
1151805306 17:76401182-76401204 CCCCGTGAGCGGTGTCTCCATGG + Intronic
1152092630 17:78255529-78255551 CCCTGGGTGGACTGCCTCCATGG + Intergenic
1155508767 18:26556310-26556332 CCCTGGGAGCAATGATGCCCTGG - Intronic
1160229419 18:77035063-77035085 CCCGGGGAGCTGTGCTTCCATGG - Intronic
1160504346 18:79418583-79418605 TCCAGGGAGCTGTGGCTCCAAGG - Intronic
1160521630 18:79511446-79511468 CACAGACAGCAGTGACTCCACGG + Intronic
1160991030 19:1860400-1860422 CCCTGGGAGCAGGGAGGCCAGGG - Intronic
1161295812 19:3519738-3519760 CCCTGGGGGCAGGGGCTCCTGGG - Intronic
1161454066 19:4361509-4361531 CCCTGGCAGCAGGGGCTCCGTGG + Exonic
1162245127 19:9393650-9393672 CCCTGAAAGCAATGAATCCAAGG + Intergenic
1162460095 19:10809823-10809845 CCCTGGGAGCAGCGAGGCCCTGG - Intronic
1162627256 19:11894614-11894636 CCCTGGGAGGAGTGACTCAGGGG - Intronic
1162687408 19:12399574-12399596 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1162691722 19:12439426-12439448 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1165448522 19:35869519-35869541 CCCAGGGAACGGTGCCTCCATGG + Intronic
1166453430 19:42919880-42919902 CCCTGGGAGCAGTGATGTCTGGG + Intronic
1166492615 19:43271523-43271545 CCCTGGGGGCAGTGATGCCTGGG + Intergenic
1167331200 19:48857430-48857452 CCCTGGGACCCGGGCCTCCATGG - Exonic
1168623652 19:57899025-57899047 CCCTGGTTGCAGTGAGCCCATGG - Intronic
925483670 2:4304295-4304317 TTCTGGGAGCAGTGCCTCTAGGG + Intergenic
925976126 2:9143300-9143322 GCCTGGCAGCAGTGACTTCGGGG + Intergenic
929450689 2:42035067-42035089 CTCAGGGAACAGTAACTCCAGGG + Intergenic
929924043 2:46194884-46194906 TCCTGGGAGCCAGGACTCCAAGG - Intergenic
932296394 2:70626785-70626807 CCCTGGGAGCTGTGACCCAGGGG + Intronic
933809889 2:86026719-86026741 GGCTGGGAGCAGTCGCTCCAGGG - Exonic
934299466 2:91768603-91768625 CTCTAGGAGCTGTTACTCCAAGG - Intergenic
934725119 2:96611590-96611612 CCCTGGGAGCAGGGACTATGGGG + Intronic
936341339 2:111635229-111635251 TTCTGGGAGCAGTGGCTCCCTGG - Intergenic
937986653 2:127641074-127641096 CCCAGGAGCCAGTGACTCCAGGG + Intronic
938109697 2:128555581-128555603 TCCAGGGAGCAGTTCCTCCAGGG + Intergenic
938163485 2:129006993-129007015 CCCTGGGAGGAGACAGTCCAGGG - Intergenic
940099547 2:150018386-150018408 CACCAGGAGCAATGACTCCAGGG - Intergenic
942731958 2:179069972-179069994 CCTTAGGAGCAATCACTCCAGGG - Intergenic
945790078 2:214293783-214293805 CTCTGGTAGCAGTGGCCCCAGGG + Intronic
945809331 2:214529326-214529348 CCATGGGTGCCCTGACTCCAGGG + Intronic
948020909 2:234732595-234732617 CCATGGGAGCAGTGACTTCTGGG - Intergenic
948055174 2:235005436-235005458 CCCTGGGGGAAGTGACGCCAGGG - Intronic
948319557 2:237058568-237058590 CGCTGGGAGCTGTCACTGCATGG + Intergenic
948542613 2:238701337-238701359 CCCTGGGAGCAGTTTCTCTGTGG + Intergenic
1170270740 20:14524662-14524684 TCAAGGGAGCAGTGAGTCCAAGG - Intronic
1170797029 20:19556950-19556972 CCCAGGGAGCAGTCAGACCATGG - Intronic
1171373669 20:24677352-24677374 CCCTGTTAGCAGAGCCTCCAAGG + Intergenic
1172204280 20:33151495-33151517 TCCTGGGAGCATTGATTCCATGG + Intergenic
1173590281 20:44219728-44219750 CCCTGTGAGCAGTGGCCACAGGG - Intergenic
1174093830 20:48071424-48071446 ACCTGGGAGCAGAGAGACCATGG + Intergenic
1174194918 20:48766323-48766345 CCCTGGGTGGAGTGACACAAAGG + Intronic
1174269614 20:49358192-49358214 CCCAGGTAGCAGGGACTACAGGG - Intergenic
1175372878 20:58504340-58504362 CCCAGGGAGCAGTGAGTTCTGGG + Intronic
1175904693 20:62373951-62373973 GCCTGGGAGCCGTCACTCCTGGG - Intergenic
1176134146 20:63512785-63512807 CCCTGGTAGCTGGGACTACAGGG - Intergenic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1180110512 21:45645981-45646003 CCCTGGTGGCAGTGACTCAGAGG + Intronic
1180701755 22:17785075-17785097 CTCTGGGAACACGGACTCCACGG + Intergenic
1180836644 22:18933035-18933057 CCCAGGCTGCACTGACTCCAGGG + Intronic
1181456198 22:23061497-23061519 CCTTGTGAGCTGTGACTCAAGGG - Intronic
1181556568 22:23674880-23674902 CTCTAGGAGCTGTCACTCCAAGG + Intergenic
1181697822 22:24602705-24602727 CTCTAGGAGCTGTCACTCCAAGG - Intronic
1182467222 22:30525030-30525052 GTCTGGGAGCAGTACCTCCACGG + Exonic
1182594895 22:31411652-31411674 CCCAGGTAGCAGGGACTACAGGG + Intronic
1183650364 22:39150120-39150142 CACTGGGAGCTGAGACTGCATGG + Intronic
1184679458 22:46062184-46062206 CCCCGGGAGCAGTGTCTCTGCGG - Intronic
1185028888 22:48431532-48431554 CCAGTGGAGCAGTGACTCCCAGG + Intergenic
1185140837 22:49100469-49100491 CCCTGAGAGCAGACAATCCACGG + Intergenic
1185228815 22:49668472-49668494 CCCTGGCAGCAGAGCCACCACGG - Intergenic
1185331975 22:50255993-50256015 CCCTGGGAGCAGCCACCACAGGG + Intronic
1203286736 22_KI270734v1_random:158334-158356 CCCAGGCTGCACTGACTCCAGGG + Intergenic
949982050 3:9508162-9508184 GCCTGGGAGCATTCCCTCCATGG - Intronic
950839578 3:15954447-15954469 CACTGGGAGCATTTACACCATGG + Intergenic
952759758 3:36903616-36903638 CCCTGGGAGCAGGGCCTATAAGG + Intronic
953742898 3:45552368-45552390 CCCTGGGAGCCGTCAGTCCCAGG - Intergenic
954611803 3:51948260-51948282 GCCTGGGACCAGTGACCCCTGGG + Intronic
955747050 3:62150248-62150270 CCCTGGGGGCAGTGTGTTCATGG + Intronic
960131899 3:114065693-114065715 CCCTGGGAGCAGTGGCGACATGG - Intronic
961509798 3:127393852-127393874 CCCTGGAAGCAGAGTCTTCAGGG + Intergenic
961558582 3:127713415-127713437 ACCTGGGAGCAGCGCCTGCAAGG - Intronic
961720439 3:128891178-128891200 CCCTGGAATCAGTAACTACATGG - Intronic
964104243 3:153022135-153022157 CCGTTGGAGCAGTGACACCAGGG + Intergenic
967988644 3:195114935-195114957 GCCTGGGCGCAGTCACTCCTGGG + Intronic
968262456 3:197335954-197335976 CCCTGGGAGCAGGCACACGAGGG + Intergenic
968974179 4:3812435-3812457 GCCTGGGAGCAGGCACTTCAGGG + Intergenic
968986460 4:3877974-3877996 CACTTGGAGCAGAGACTCCGAGG + Intergenic
972299680 4:37773117-37773139 CACTGGGAGAAGTTCCTCCAGGG - Intergenic
984019955 4:174473704-174473726 CCCTGGGACTAGTAACTGCAGGG + Intergenic
984131315 4:175878697-175878719 CCCTGGGAGCATTTTCCCCATGG + Intronic
985552921 5:542431-542453 CCCTGGGAGCACAGGCCCCATGG + Intergenic
985639849 5:1058498-1058520 CCCTGGGACGAGTGGCTCCCCGG - Intronic
985754467 5:1704852-1704874 CCCAGGGAGCAGTGAGTACACGG - Intergenic
990448373 5:55913955-55913977 AGCGGGGAGCAGTGTCTCCACGG + Intronic
991462089 5:66869887-66869909 CACTGTGAGCATTAACTCCAGGG - Intronic
993982398 5:94558268-94558290 CTCTGGGAGCAAGGACTCCCTGG + Intronic
995692189 5:114839489-114839511 TCCTGAGAGCAGTTACCCCAGGG - Intergenic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG + Intronic
999436962 5:151570668-151570690 CCCTGGGAGCCTTGATTCCTAGG + Intergenic
999678668 5:154033821-154033843 CACTGGGACCAGGGATTCCAAGG + Exonic
999715010 5:154353466-154353488 CACTGGCCACAGTGACTCCAAGG - Intronic
999772211 5:154784245-154784267 CCCTGGGGGCAGGGACCACAGGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
999996775 5:157099818-157099840 CCCTGGTAGCTGGGACTACAGGG + Intronic
1000006984 5:157194893-157194915 GCCTGGGAGCACTGAATCCTTGG + Intronic
1003128842 6:3377973-3377995 TCCTGGGAGCAATTCCTCCAGGG + Intronic
1007706023 6:43791959-43791981 CCCAGGGAGCAGTGAGTCAGAGG + Intergenic
1011694477 6:89899615-89899637 CCCTCTGTACAGTGACTCCATGG - Intergenic
1013589190 6:111605950-111605972 CCCTGTGGGCAGTGAATCAACGG + Exonic
1014589246 6:123242989-123243011 CAGTGGCAGCATTGACTCCAGGG - Intronic
1018056953 6:160060410-160060432 TCGTGGGAGCAATGACACCAGGG - Intronic
1018915568 6:168130544-168130566 CCCTGACAGCATTGACGCCAGGG + Intergenic
1020052211 7:5089145-5089167 CCCTTGGGGCAGAGACTCCACGG - Intergenic
1022626604 7:32043211-32043233 CCATTGGACCAGTGTCTCCAGGG + Intronic
1024044440 7:45577142-45577164 CCCTGCTAGCTGTGACTCCCTGG + Intronic
1025946034 7:66105277-66105299 CCCCGGGAGCAGTGGTTGCAGGG + Intronic
1029526918 7:101100374-101100396 CCATGTGAGCAGTGACTGTAGGG + Intergenic
1030359378 7:108579456-108579478 CACTGGGAGCAGGGAGTCCACGG - Intergenic
1032074949 7:128831831-128831853 TCTTGGGAGCAGAGACGCCAAGG + Intronic
1032486361 7:132290383-132290405 CCCTGGTAGGGGTCACTCCAGGG + Intronic
1032645673 7:133821359-133821381 GGCTGGGAGCACTGACTCCAGGG - Intronic
1033651333 7:143346092-143346114 GCCTGGGAGCAGAGACTGCCTGG - Intronic
1034487210 7:151373568-151373590 CCTGGGGAGCAAGGACTCCAGGG - Intronic
1034496573 7:151426979-151427001 CCTTGGGCCCAGTGCCTCCAAGG + Intergenic
1034557431 7:151858988-151859010 CCCTGGCCTCAGTGACTCAAGGG + Intronic
1035080009 7:156208144-156208166 CCTGGAGAGCTGTGACTCCATGG + Intergenic
1036452803 8:8883264-8883286 CCCAGGGAACAGGGACGCCAAGG + Intronic
1038340282 8:26680218-26680240 TCCTGGGAGCCCTTACTCCAAGG + Intergenic
1038724419 8:30067848-30067870 ACCTGGGAGAAGTGAATGCATGG - Intronic
1039552054 8:38450487-38450509 CCCTGGGAGAAGTGAGTCCTGGG - Intronic
1040598938 8:48865521-48865543 CCCCGGGAGCAGGGCTTCCATGG + Intergenic
1040737783 8:50531646-50531668 CCCTGTGAGCTCTGACTCCCAGG - Intronic
1041012452 8:53558494-53558516 CCCTGGGAGCCTTGGATCCAGGG + Intergenic
1041381350 8:57257592-57257614 CCCGAGAAGCAGGGACTCCATGG + Intergenic
1043517060 8:81004733-81004755 GCCTGGCAGCAGAGGCTCCATGG + Intronic
1043763542 8:84100110-84100132 CCTTGGGAACAGGGCCTCCAAGG - Intergenic
1043821876 8:84876590-84876612 CAATGGGAACAGTTACTCCATGG + Intronic
1044841136 8:96338119-96338141 CCCTCGGAGCAGTCATCCCAGGG + Intergenic
1048574577 8:135680696-135680718 CCGTGGGACCAGGGCCTCCAGGG - Intergenic
1049212479 8:141393015-141393037 ACCTGGGAGCAGGGCCCCCAGGG - Intronic
1049411174 8:142474651-142474673 CCCCGGGAGCAGAGACTCCTGGG + Intronic
1049570292 8:143367154-143367176 CCCAGGGAGCAGACACTTCAAGG + Intergenic
1049619064 8:143589630-143589652 CCATGGGTGCAGAGACCCCAAGG + Exonic
1049751034 8:144284171-144284193 CCCTGGTAGCTGGGACTACAGGG - Intronic
1050593566 9:7183921-7183943 CCCTGGGAGCAAGGACCCCCTGG + Intergenic
1053125569 9:35578029-35578051 CCCAGGGACCAGTGAGTCGAGGG - Intergenic
1055476608 9:76669188-76669210 CTGTGGGTGCAGTGACCCCATGG - Intronic
1055751902 9:79515521-79515543 CCCAGAGAGCAGTCAGTCCAAGG - Intergenic
1057888875 9:98852932-98852954 CCCTGGCAGGTGTGAATCCAGGG + Intergenic
1060656177 9:125374219-125374241 CCCTAGGAGCACAGGCTCCAGGG - Intergenic
1060967873 9:127721590-127721612 CCCTGGCAGGAGTGACTTCGGGG + Intronic
1060968275 9:127723680-127723702 CCCTGGCAGGAGTGACTCCAGGG + Intronic
1062208972 9:135353037-135353059 CCCTGGGATGAGTGCCTCAAAGG - Intergenic
1062387452 9:136318622-136318644 CCCTGGGCCCAGGGCCTCCAGGG - Intergenic
1062423130 9:136493642-136493664 CCCTGGGCCCAGTCTCTCCAAGG - Intergenic
1186099958 X:6145380-6145402 ACCTGGAAGCATTGAATCCAAGG - Intronic
1186896773 X:14011588-14011610 CTCTGGATGCAGAGACTCCAAGG - Intronic
1186974903 X:14891690-14891712 CCCTGGTAGCTGAGACTACAGGG + Intronic
1187097273 X:16161865-16161887 CACTGGGTGGACTGACTCCAGGG + Intergenic
1189672067 X:43422103-43422125 CCCAGGGAGCAGTGATTTTATGG - Intergenic
1190068039 X:47256226-47256248 CCCTGGTAGCTGGGACTACAGGG + Intergenic
1190301300 X:49059102-49059124 ACCTGGGAGCAGTGGGCCCAGGG + Intronic
1190455719 X:50626156-50626178 CCCAGGCAGAACTGACTCCAAGG + Intronic
1194103208 X:89734209-89734231 CTCTGGGAGCAATGACCCCCTGG - Intergenic
1194853343 X:98896918-98896940 CCCTGGGACAAGTCACTCAAAGG + Intergenic
1197522642 X:127519456-127519478 CCCTGGGACCAGAGCCCCCAGGG + Intergenic
1198159854 X:133997005-133997027 CCATAGGAGCAGTTACACCAAGG - Intergenic
1199259656 X:145756793-145756815 CCCTGGGAACAGTTACACCATGG - Intergenic
1202089747 Y:21177494-21177516 CCCTGTGTGCAATAACTCCATGG + Intergenic