ID: 996334988

View in Genome Browser
Species Human (GRCh38)
Location 5:122373841-122373863
Sequence TGGATTTACACCCAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996334988_996335000 25 Left 996334988 5:122373841-122373863 CCCACCCCTTGGGTGTAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 996335000 5:122373889-122373911 TGAAGGTGGTTTCTGTACTTTGG 0: 1
1: 0
2: 0
3: 16
4: 197
996334988_996335002 29 Left 996334988 5:122373841-122373863 CCCACCCCTTGGGTGTAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 996335002 5:122373893-122373915 GGTGGTTTCTGTACTTTGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 447
996334988_996334998 11 Left 996334988 5:122373841-122373863 CCCACCCCTTGGGTGTAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 996334998 5:122373875-122373897 ACAGAAGCATTCCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 34
4: 676
996334988_996335001 26 Left 996334988 5:122373841-122373863 CCCACCCCTTGGGTGTAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 996335001 5:122373890-122373912 GAAGGTGGTTTCTGTACTTTGGG No data
996334988_996334997 8 Left 996334988 5:122373841-122373863 CCCACCCCTTGGGTGTAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 996334997 5:122373872-122373894 CCAACAGAAGCATTCCTTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996334988 Original CRISPR TGGATTTACACCCAAGGGGT GGG (reversed) Intronic
900804043 1:4755788-4755810 GGAATTTGCAGCCAAGGGGTAGG + Intronic
900883417 1:5398709-5398731 TGGGTTATCACTCAAGGGGTAGG + Intergenic
920828086 1:209440739-209440761 TGGATTTAAAACCAAAGGGCAGG + Intergenic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
1063403937 10:5774874-5774896 TGGATTCACACCCAGGGGAAGGG + Intronic
1068313950 10:55317811-55317833 TGGCTGAACGCCCAAGGGGTTGG + Intronic
1068547150 10:58360478-58360500 TGGAATTACAACCCAGGGGCGGG + Intronic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069234540 10:66054222-66054244 TGGATATACATCCAAAGGGAAGG - Intronic
1070760568 10:79021684-79021706 TGCATTAGCACCCAAGGGATGGG - Intergenic
1074428838 10:113375498-113375520 TGGATTCACACATAAGTGGTAGG + Intergenic
1076108219 10:127841469-127841491 TGGCTTTCTACCCAAGGGGGAGG + Intergenic
1083033399 11:59615154-59615176 CGGATTGACAGCCCAGGGGTCGG - Intronic
1086191534 11:84084902-84084924 GGGATTTACAGCCAAGGAGCAGG - Intronic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG + Intronic
1092467859 12:8749921-8749943 TCACTTTGCACCCAAGGGGTTGG - Exonic
1101422945 12:104564273-104564295 GGGATCTACACCCAAGTGTTTGG - Intronic
1102061899 12:109938854-109938876 TGCATTTGTACCCAAGGAGTTGG - Intronic
1107309856 13:39065020-39065042 TGGATTTATACCCCAGAAGTGGG + Intergenic
1108672510 13:52706182-52706204 AGAATTTACACCCAAGAGATTGG + Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1114811759 14:25908885-25908907 TGGATTTAAATCCCAGGTGTAGG + Intergenic
1116425318 14:44783469-44783491 GGAATTTACAGCCAAGGAGTAGG + Intergenic
1118227347 14:63914375-63914397 TGAATTGAAACCCAAGGGTTTGG + Intronic
1120579344 14:86227115-86227137 TGTATTTACAACCATGGGGAAGG - Intergenic
1127605360 15:60582049-60582071 TTGATTTAAAACCAAGGGGCGGG - Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1132289802 15:100691716-100691738 TGGACTTTTACCCAAGGGATTGG - Intergenic
1133452446 16:5915040-5915062 TGAGTTTACACCCAAGGGGAGGG + Intergenic
1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG + Intronic
1137376056 16:47952831-47952853 GGGATTTACAGCCAAGCAGTAGG + Intergenic
1138082012 16:54099701-54099723 TGGGTTTACACCTCAGTGGTGGG + Intronic
1139574588 16:67833024-67833046 AGGTTTTACACCCATGAGGTAGG - Intronic
1144780264 17:17804629-17804651 TGGATTCAAACCCTAGTGGTGGG + Intronic
1147438257 17:40431159-40431181 TATATTTACACCCAAGTGCTGGG - Intergenic
1148350891 17:46941297-46941319 TGGATTTACACCCATTGTTTTGG + Intronic
1152732746 17:81980691-81980713 GGGATTTACACCGAATGGGGTGG + Intronic
1153137971 18:1939980-1940002 TGGATATACACCCAAAGGAAAGG - Intergenic
1154162187 18:11989040-11989062 TGGATTTGCACCCAAGCTGACGG + Intronic
1154273104 18:12936859-12936881 TGAATTAGCACCCAAGGGGCTGG - Intergenic
1154387047 18:13903339-13903361 TGGATATATACCCAAAGGGAAGG + Intronic
1157779554 18:50425538-50425560 TGGATTAACATCCAAAGGCTGGG - Intergenic
1161216377 19:3096889-3096911 GGGCTTCACACCCAAGGTGTTGG + Intronic
1161928571 19:7320252-7320274 TGGGTGTACACCCAAGGTTTGGG - Intergenic
1163088543 19:15001629-15001651 TGGCTTTACAACCAATAGGTGGG - Intronic
1164212093 19:23107832-23107854 TACAGTTTCACCCAAGGGGTGGG - Intronic
927498370 2:23565469-23565491 TGGAGTCCCAGCCAAGGGGTAGG - Intronic
927853915 2:26516273-26516295 TGGAGAGACATCCAAGGGGTGGG - Intronic
929869875 2:45750081-45750103 TTGTTCTACACCCAAAGGGTTGG + Intronic
930009902 2:46928823-46928845 TGCAGTTACACCAGAGGGGTAGG + Intronic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
932901617 2:75707636-75707658 TGGATTAACACCAAAGCAGTGGG + Intronic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
936508556 2:113127699-113127721 TGGATTTTCTCCCAGAGGGTCGG - Exonic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
941506820 2:166356638-166356660 TGGATGGATACACAAGGGGTTGG - Intronic
941868031 2:170354932-170354954 TGGATTGACATCCTGGGGGTGGG + Intronic
945293793 2:208150669-208150691 GGGATTTACAACCTAGGAGTGGG + Intergenic
945860545 2:215116474-215116496 TGGATTTACTGCAAAGGGATTGG + Intronic
1170537654 20:17357221-17357243 TGCATTTACATCCAAGAGCTTGG + Intronic
1171153353 20:22847264-22847286 TGGCTTTTCACTCAAGTGGTGGG - Intergenic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1178830271 21:36050451-36050473 TCACTTTGCACCCAAGGGGTTGG - Intronic
1179010808 21:37554613-37554635 TGGACATACACCCAAGGGGCTGG + Intergenic
1179359638 21:40693894-40693916 TGGATTTGAACCCAGGGAGTTGG - Intronic
1179460919 21:41534532-41534554 TTGATGTAAAACCAAGGGGTGGG + Intergenic
1179463883 21:41557886-41557908 TGGATATACACAGAAGGGGCAGG + Intergenic
1182957599 22:34441944-34441966 TGGGTTTAAACCCCAGAGGTGGG + Intergenic
1184614339 22:45627809-45627831 TGGATTTCAACGCAAGGGGGTGG + Intergenic
950271563 3:11620241-11620263 TGGATTTACACCCAAAGGTCTGG + Intronic
953605421 3:44410356-44410378 TCGATTTTCACCCATGGGATGGG - Intergenic
956724611 3:72146564-72146586 TGGATTGTCCCACAAGGGGTGGG + Intergenic
967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG + Intronic
989554835 5:42781751-42781773 TGTATTTACACACAAGGAGTTGG + Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG + Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
1000168266 5:158676713-158676735 TGGAGTTGCACCCAAAGAGTGGG - Intergenic
1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG + Intronic
1001368962 5:171176842-171176864 AGGATTCACACCCAAATGGTGGG - Intronic
1008442090 6:51543419-51543441 TGGAAAAACACCCCAGGGGTTGG - Intergenic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1010394626 6:75376432-75376454 TTGTTTGACTCCCAAGGGGTGGG - Intronic
1010502492 6:76617869-76617891 AGGATTTAAACCCAAGGGAAGGG + Intergenic
1013756341 6:113466089-113466111 TTGGTTTTCAACCAAGGGGTTGG + Intergenic
1013774367 6:113663235-113663257 GGGATTTCCACCCAAGGTGATGG + Intergenic
1013819764 6:114140604-114140626 TGGATTCACAGCCAAGGTGAGGG - Intronic
1014508627 6:122292211-122292233 AGGATTCAAACCCAAGGAGTTGG + Intergenic
1016751883 6:147639528-147639550 GGGCTTCACTCCCAAGGGGTGGG + Intronic
1024889810 7:54186926-54186948 GAGTTTTACAGCCAAGGGGTAGG + Intergenic
1026408308 7:70091816-70091838 TGGATTTATACCCAACATGTAGG + Intronic
1029899162 7:104021870-104021892 TGGATTTGCAGCCATGGGTTGGG - Intergenic
1031419712 7:121536769-121536791 TGGATTTTCACCCAACTGATGGG + Intergenic
1034316392 7:150137150-150137172 TTGATTCACAGCCCAGGGGTTGG + Intergenic
1034790470 7:153963527-153963549 TTGATTCACAGCCCAGGGGTTGG - Intronic
1038186584 8:25280498-25280520 TGCTTTTCCACCAAAGGGGTTGG - Intronic
1038865128 8:31431233-31431255 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1039116105 8:34092898-34092920 TTGATTTACACTCAAGAGGGTGG + Intergenic
1040676498 8:49757107-49757129 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1043661834 8:82752982-82753004 GGGATTTACAGCCCAAGGGTGGG + Intergenic
1046920799 8:119726276-119726298 TGGATTCAAACCCAAGGGCCTGG - Intergenic
1048583408 8:135749909-135749931 TGGGTTCACAGCCTAGGGGTTGG - Intergenic
1051351137 9:16198863-16198885 TGGATTTACATGCAAGCGGGTGG - Intergenic
1055037089 9:71829293-71829315 GAGATTTACAACCAAGGAGTAGG + Intergenic
1057866695 9:98687218-98687240 GGGATTTACAGCCAAGGGGCAGG + Intronic
1059192210 9:112336993-112337015 TGAATTTAGAACCAAGGGGCAGG - Intergenic
1060962304 9:127689808-127689830 TGGATTTCCACCCCAAGGGCAGG - Intronic
1062614061 9:137388114-137388136 TGGATTCACATCCAAGAGCTGGG + Intronic
1186550283 X:10497582-10497604 GGGATTTACAGCCAAGGAGCAGG - Intronic
1187281891 X:17863773-17863795 TGGGTGAACACCCAAGGAGTGGG + Intergenic
1187847638 X:23557171-23557193 TGGATTCACATCCAAAGGCTAGG + Intergenic
1188914389 X:35891520-35891542 TGGATTTCAACCCTAGGGGAGGG + Intergenic
1189078503 X:37943438-37943460 GGGATTTACAACCAAGGAGCAGG + Intronic