ID: 996335237

View in Genome Browser
Species Human (GRCh38)
Location 5:122377087-122377109
Sequence ACTTCAAGGGTAAATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996335237_996335243 21 Left 996335237 5:122377087-122377109 CCTCCAAGATTTACCCTTGAAGT 0: 1
1: 0
2: 0
3: 3
4: 130
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996335237 Original CRISPR ACTTCAAGGGTAAATCTTGG AGG (reversed) Intronic
903510138 1:23868526-23868548 ACTGCGAGGTTAAATCGTGGAGG + Intergenic
904621439 1:31777631-31777653 ACTTCCTGGGGAAATCTGGGAGG - Intergenic
917468039 1:175300457-175300479 AATTCAAGGGAAAAAATTGGTGG + Intergenic
917619217 1:176778836-176778858 ATTTCAAGGATAAATTTTGAAGG - Intronic
917810734 1:178655920-178655942 AATTCAAGGGGCAATCTGGGTGG + Intergenic
918207261 1:182320515-182320537 AATTCACTGGTACATCTTGGTGG + Intergenic
918248052 1:182677777-182677799 ATTTCAAAGTTAAATTTTGGAGG + Intronic
921987197 1:221325188-221325210 ACTTCAAGGCTATATCTGGAAGG + Intergenic
922942093 1:229476202-229476224 AATTTAAGAGTAAATTTTGGAGG + Intronic
1063748507 10:8914803-8914825 AATTCATGGGTAAAACTTTGAGG - Intergenic
1064447706 10:15410554-15410576 CCTACTAGGGTAAATCTTTGAGG + Intergenic
1065034467 10:21623322-21623344 ACTAATAAGGTAAATCTTGGAGG - Intronic
1065223888 10:23523420-23523442 ACTTCCAGGGTAAAGGTTGCTGG - Intergenic
1065442751 10:25769597-25769619 ACTTCAAGGGTTAAGAGTGGCGG + Intergenic
1069653414 10:70068871-70068893 ACTTCATTGGAAAATATTGGAGG + Intronic
1070894486 10:79971565-79971587 ACTTCTTGGTTCAATCTTGGTGG + Intronic
1073100180 10:101002370-101002392 ACTTGAAGGGGGAGTCTTGGTGG + Exonic
1074355022 10:112774856-112774878 AGTTCAAGGGTACATGTTTGAGG + Intronic
1077651424 11:3976397-3976419 ACTACAAGGGGAAAGCATGGAGG + Intronic
1080915812 11:36657565-36657587 ACTTCAAGGTTGATTCTTGCTGG + Intronic
1081007686 11:37767365-37767387 ACTTCCAGGGGAAGGCTTGGAGG - Intergenic
1081834687 11:46143857-46143879 ACTTCCAGGGGAAAGCTGGGGGG + Intergenic
1084101925 11:66955432-66955454 CCTTCTAGGGGAGATCTTGGAGG + Intronic
1086745433 11:90420672-90420694 ACTCCAAGGGTAAATTCTTGAGG - Intergenic
1087823661 11:102740400-102740422 TCTTCATGGTTCAATCTTGGTGG + Intergenic
1087959640 11:104332677-104332699 ACTTCAAGGATAAGTATTGTTGG + Intergenic
1092515400 12:9206671-9206693 ACATCAAGGGTTAATTCTGGAGG + Intronic
1094408024 12:30139333-30139355 ACATAAAGGGAAAATCTTGAAGG + Intergenic
1097887287 12:64741668-64741690 ACTTCAAGTCTAAATCTGGAGGG + Intronic
1098575196 12:72033807-72033829 ACTACAAGGGGAAAGCTTGATGG - Intronic
1099520269 12:83651510-83651532 ACTTCATAGTTAATTCTTGGTGG - Intergenic
1100154984 12:91787804-91787826 ATTTCTAGGGAAAATCCTGGGGG - Intergenic
1102098118 12:110256724-110256746 ACTTTAAGGGTGCATCATGGAGG + Intergenic
1105903447 13:24779271-24779293 CCTTCAAGTGTAAATCTTAATGG + Intronic
1110078674 13:71283343-71283365 TCTTCATGGTTCAATCTTGGTGG + Intergenic
1110624746 13:77640413-77640435 AAATCAAGAGTAAATCTGGGTGG - Intronic
1111994655 13:95152885-95152907 ACTTCAAAGTCAAATCTTTGAGG + Intronic
1114568781 14:23651280-23651302 ACTACAGGGGTACATCATGGAGG + Intergenic
1115655032 14:35435249-35435271 GCTTCAAGGGAAAATATTGTGGG + Intergenic
1115808127 14:37075240-37075262 ACTTCATGGGTGGTTCTTGGTGG + Intronic
1117462314 14:55957325-55957347 ACTTCAAGGGAAAGGCTTTGAGG + Intergenic
1119879878 14:78091770-78091792 ACCTCAAGGGAAAATCTATGCGG - Intergenic
1120684095 14:87517734-87517756 AATTCAAGGTGAAATCTGGGTGG + Intergenic
1126792721 15:52235656-52235678 AGTTAAAAGGTAAAGCTTGGGGG - Exonic
1127177691 15:56378426-56378448 TCTTCATGGTTCAATCTTGGTGG + Intronic
1127731334 15:61805047-61805069 ACTTTATGTGTAAACCTTGGTGG - Intergenic
1129364595 15:75046583-75046605 ACTTCGAGGGAAAACCTTTGAGG - Intronic
1131574203 15:93570244-93570266 ACTTCAAGTATAACTGTTGGGGG - Intergenic
1132966929 16:2661544-2661566 ACTTAAAGAGCAAATCTTTGAGG - Intergenic
1133834541 16:9355516-9355538 AATTCAAGATTAAATCTGGGTGG - Intergenic
1134298798 16:12971158-12971180 ACTTCAAGACTAAAACTTCGGGG + Intronic
1138143915 16:54591917-54591939 AGTTCAAGGGTCAATCTTCAAGG - Intergenic
1140603338 16:76504523-76504545 AATACAAGGGAAAATCTTAGTGG + Intronic
1141878877 16:86845115-86845137 ATTTCAAAGGCCAATCTTGGAGG - Intergenic
1144035684 17:11363469-11363491 ACTGAAAGAGTAAATATTGGTGG + Intronic
1150283049 17:63940514-63940536 ACTTGCAGGTTAAATCTTGGAGG + Exonic
1151058147 17:71057947-71057969 ACTTTAAGGGTAATTTATGGAGG + Intergenic
1153272620 18:3337754-3337776 ATTTCAAAGGTAAATATAGGAGG - Intergenic
1155430565 18:25751878-25751900 TCTTCATGGTTCAATCTTGGTGG - Intergenic
1156351792 18:36308444-36308466 AGTTCAAGTGTCAGTCTTGGAGG - Intronic
1159116910 18:64125099-64125121 ATTTCAAGGATGAATGTTGGTGG - Intergenic
1159163400 18:64672852-64672874 AGTACAAGGTCAAATCTTGGGGG - Intergenic
1159291300 18:66425040-66425062 ACATCATGGGTAAATCTGGTAGG + Intergenic
1164083605 19:21881529-21881551 ACTTAAAGAGCAAATCTTTGAGG - Intergenic
925732658 2:6931362-6931384 ACTTCAAAGGAAAACCTTGAAGG + Intronic
926827869 2:16926530-16926552 ACATCAAGGGAACATCTTGTGGG - Intergenic
927782756 2:25952896-25952918 ACTTGAAGGATAAATGTTTGAGG + Intronic
927784304 2:25962179-25962201 ACTTCAAGAGTTAACCCTGGAGG + Intronic
931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG + Intergenic
938231585 2:129666037-129666059 ACTCAAAGGATAAATGTTGGAGG + Intergenic
939732948 2:145808041-145808063 ACATGTAGGGCAAATCTTGGAGG - Intergenic
940774240 2:157870258-157870280 AGTTCAAGGTTATATTTTGGAGG + Intronic
942680509 2:178473750-178473772 ACTTCTAGGCAAAATGTTGGAGG - Intronic
945438052 2:209842291-209842313 GATTCAAAGGTAAATCTTTGTGG - Intronic
1173133746 20:40420517-40420539 GATTCAAGATTAAATCTTGGAGG + Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1175205200 20:57305948-57305970 ACACCAAGGGCAAATCTGGGAGG - Intergenic
1178988737 21:37333339-37333361 ACTCGAAGGATAAATGTTGGAGG - Intergenic
1183173448 22:36204734-36204756 AATTCCTGGGTATATCTTGGGGG - Exonic
1183178191 22:36239547-36239569 AATTCCAGGGTATATCTGGGAGG - Exonic
950671401 3:14528028-14528050 ACATCAAGGGAGAATTTTGGGGG - Intronic
953207902 3:40848134-40848156 CCTTCTAGGGTCATTCTTGGAGG + Intergenic
957240109 3:77648872-77648894 ACTGCAAGAGGAAATCTGGGTGG + Intronic
959587672 3:108040181-108040203 ACTTCAAGGATAATTCTTTTAGG + Intergenic
960171213 3:114463342-114463364 AGTTCAGGGGGAAACCTTGGAGG - Intronic
962035429 3:131646608-131646630 ACTCAAAGGGTAAATGTTTGAGG + Intronic
964449068 3:156792527-156792549 ACTACAGGGGTAAATCCTGTGGG + Intergenic
964546339 3:157838613-157838635 ATATCCAGGGTACATCTTGGAGG - Intergenic
966588581 3:181654132-181654154 GCTTCAAGGGCAAATTTAGGTGG - Intergenic
967112644 3:186308071-186308093 ACATTAAGGGGAAATCATGGCGG - Intronic
970614245 4:17752932-17752954 CCTTCAAGGGCAAATAGTGGAGG - Intronic
971486116 4:27162256-27162278 ACTCCAAGGGTAAATCTGAGGGG + Intergenic
972549315 4:40113500-40113522 ACTTGCAAGGTAAAACTTGGAGG + Exonic
975454624 4:74575646-74575668 ATTCCAAGGGTAGAACTTGGAGG - Intergenic
976979686 4:91211938-91211960 ATTTCAATGGTAATCCTTGGTGG - Intronic
977613567 4:99062162-99062184 ACTTCAAGGGCATACCTTGGAGG + Exonic
977788974 4:101075166-101075188 AATTCAAGGTGAAATCTGGGTGG + Intronic
977865902 4:102027041-102027063 ACTTCATGGATAAATGTTGAGGG - Intronic
980179638 4:129388205-129388227 ACTTCAAGATTAAATCTGAGAGG - Intergenic
980737964 4:136915988-136916010 ACCTCAAGGGTAAAACTTTTTGG - Intergenic
981140538 4:141263138-141263160 TCTTCATGGCTCAATCTTGGTGG - Intergenic
982544976 4:156723112-156723134 ACTTAATGGGTTAATTTTGGAGG - Intergenic
989164274 5:38419249-38419271 ACTTCAACTGTGAATTTTGGGGG + Intronic
990209573 5:53468221-53468243 ACTTCAAAAGTACATTTTGGAGG + Intergenic
991147760 5:63326916-63326938 ACTTCAAGTATACATCTTGATGG - Intergenic
992467547 5:77021904-77021926 ACTTCTGGGGAAAATGTTGGAGG + Intergenic
993180706 5:84548653-84548675 ACTTCAGGGGTAAATAAGGGAGG - Intergenic
995207194 5:109494197-109494219 ACTTCAATTGGAATTCTTGGAGG + Intergenic
996335237 5:122377087-122377109 ACTTCAAGGGTAAATCTTGGAGG - Intronic
996944873 5:129055073-129055095 GCTTGAAGGGTAAAACTTGTTGG + Intergenic
997003515 5:129790684-129790706 ACTGCAGGGGAAAATCTTGAAGG + Intergenic
997435596 5:133872202-133872224 AATTCAAGGATAAATCTAAGAGG + Intergenic
1003311270 6:4971817-4971839 ACTTCAACAGTGAATTTTGGGGG + Intergenic
1012397267 6:98813148-98813170 ACTTCAAGGCTTAATCATTGTGG + Intergenic
1014118752 6:117698450-117698472 TCTTCATGGTTCAATCTTGGTGG - Intronic
1017257977 6:152355575-152355597 ATTTGTAGGGTAAATCTTTGGGG - Intronic
1018601972 6:165553883-165553905 ACAGAAAGGGTAAATTTTGGTGG - Intronic
1024890282 7:54192765-54192787 ACTTTAACAGTAAACCTTGGTGG + Intergenic
1031651937 7:124302350-124302372 ACGTCAAGGGAAGAACTTGGTGG + Intergenic
1032373073 7:131379724-131379746 ACTTGAAGGATAAATGTTTGAGG + Intronic
1032988304 7:137362814-137362836 AATTCAAGGTGAAATTTTGGTGG + Intergenic
1036027259 8:4923399-4923421 ACTCAAAGGATAAATGTTGGAGG + Intronic
1043811451 8:84746574-84746596 ATTTCAAGAGTAAAGTTTGGTGG - Intronic
1044358935 8:91258804-91258826 ACTAGCAGGGTAAATTTTGGTGG - Intronic
1044491177 8:92817136-92817158 ACATGAAGGGTAAATCTTAATGG + Intergenic
1046150289 8:110215070-110215092 TCTTCATGGTTGAATCTTGGAGG - Intergenic
1056277884 9:85011177-85011199 CCTTCCTGGGTAACTCTTGGTGG - Intronic
1056517044 9:87363343-87363365 TCTTCATGGTTCAATCTTGGTGG - Intergenic
1057921138 9:99098124-99098146 ACTGGAAGTGTAAACCTTGGGGG - Intergenic
1186856305 X:13629545-13629567 AGTTCTAGGGGAAATCTTGATGG + Intronic
1194437811 X:93890653-93890675 TCTTCCTGGTTAAATCTTGGTGG + Intergenic
1195488663 X:105440751-105440773 AATTCAAGGTGAAATTTTGGTGG - Intronic
1196120115 X:112040975-112040997 TCTTCAGGGGAAAGTCTTGGAGG + Intronic
1197495908 X:127179301-127179323 ACTTAAAGGATAAATCATTGAGG + Intergenic