ID: 996335237

View in Genome Browser
Species Human (GRCh38)
Location 5:122377087-122377109
Sequence ACTTCAAGGGTAAATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996335237_996335243 21 Left 996335237 5:122377087-122377109 CCTCCAAGATTTACCCTTGAAGT 0: 1
1: 0
2: 0
3: 3
4: 130
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996335237 Original CRISPR ACTTCAAGGGTAAATCTTGG AGG (reversed) Intronic