ID: 996335243

View in Genome Browser
Species Human (GRCh38)
Location 5:122377131-122377153
Sequence AGATCTTTAGATTCTTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996335241_996335243 -7 Left 996335241 5:122377115-122377137 CCTCCTTTTACTTGCGAGATCTT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164
996335238_996335243 18 Left 996335238 5:122377090-122377112 CCAAGATTTACCCTTGAAGTTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164
996335237_996335243 21 Left 996335237 5:122377087-122377109 CCTCCAAGATTTACCCTTGAAGT 0: 1
1: 0
2: 0
3: 3
4: 130
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164
996335242_996335243 -10 Left 996335242 5:122377118-122377140 CCTTTTACTTGCGAGATCTTTAG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164
996335240_996335243 7 Left 996335240 5:122377101-122377123 CCTTGAAGTTAAATCCTCCTTTT 0: 1
1: 0
2: 1
3: 34
4: 296
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164
996335239_996335243 8 Left 996335239 5:122377100-122377122 CCCTTGAAGTTAAATCCTCCTTT 0: 1
1: 0
2: 0
3: 20
4: 258
Right 996335243 5:122377131-122377153 AGATCTTTAGATTCTTAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996335243 Original CRISPR AGATCTTTAGATTCTTAGAG AGG Intronic