ID: 996337809

View in Genome Browser
Species Human (GRCh38)
Location 5:122403878-122403900
Sequence CAGGATAAGGAGAAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 760}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996337809_996337819 22 Left 996337809 5:122403878-122403900 CCTCCCCTCTTCTCCTTATCCTG 0: 1
1: 0
2: 5
3: 75
4: 760
Right 996337819 5:122403923-122403945 AAAGCTGTTTTTCCTCACACTGG 0: 1
1: 0
2: 3
3: 15
4: 228
996337809_996337815 -8 Left 996337809 5:122403878-122403900 CCTCCCCTCTTCTCCTTATCCTG 0: 1
1: 0
2: 5
3: 75
4: 760
Right 996337815 5:122403893-122403915 TTATCCTGGCTCAGTGTTAATGG 0: 1
1: 0
2: 0
3: 13
4: 126
996337809_996337817 -1 Left 996337809 5:122403878-122403900 CCTCCCCTCTTCTCCTTATCCTG 0: 1
1: 0
2: 5
3: 75
4: 760
Right 996337817 5:122403900-122403922 GGCTCAGTGTTAATGGCTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996337809 Original CRISPR CAGGATAAGGAGAAGAGGGG AGG (reversed) Intronic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900719561 1:4166569-4166591 CTGGAGAAGGAGCAGAGTGGAGG - Intergenic
900896692 1:5487611-5487633 TAGGATAATGAGAAGAGCTGGGG - Intergenic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901081857 1:6588214-6588236 CAGGATGGGGAGGCGAGGGGAGG - Intronic
901128060 1:6943194-6943216 GGGGAGGAGGAGAAGAGGGGAGG - Intronic
901167276 1:7229572-7229594 GAGGGTGAGGAGAGGAGGGGAGG + Intronic
902659859 1:17893442-17893464 GGGGATGAGGAGAAAAGGGGAGG - Intergenic
902664517 1:17928077-17928099 CAGGAGAAGGAAGAGAGGGGCGG - Intergenic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902864771 1:19270694-19270716 CAGGATAAGGAGAGCAGCAGTGG + Intergenic
902866990 1:19286131-19286153 CAGGATAAGGAGAGCAGCAGTGG + Intronic
903362126 1:22783388-22783410 CGGGAGAAGGACAGGAGGGGTGG + Intronic
903900376 1:26640453-26640475 CAGGATCAGGAGGTGATGGGCGG - Intergenic
903901294 1:26647585-26647607 CAGGATCAGGAGGTGATGGGCGG + Intergenic
904213226 1:28899430-28899452 CAGGAAAGGGGGAAGAGGGGAGG - Intronic
904538095 1:31214714-31214736 CAGGATAAGGAGGAAAGGGAGGG + Intronic
905393968 1:37655636-37655658 CAGGGTAATGTGAAGAGGAGAGG - Intergenic
905825204 1:41021592-41021614 CAGGAAGAGGAGGAGAGGAGAGG + Exonic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906180845 1:43817591-43817613 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
906439399 1:45827932-45827954 GAGGCTGAGGAGAAGCGGGGAGG - Intronic
907378796 1:54067551-54067573 CAGGAAAAGGAAAAGAGGAAAGG - Intronic
907754654 1:57299972-57299994 GAGGATGAGGAGAGAAGGGGAGG - Intronic
907875883 1:58487900-58487922 TAGGATCAGGAGAAGAGGTACGG - Intronic
907990982 1:59582556-59582578 TAGGAGAAGGAGTAGAGGGAAGG - Intronic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
913104282 1:115597381-115597403 CATGATAAGGGGAAAAGAGGAGG + Intergenic
913458208 1:119055721-119055743 GAGGAGGAGGAGAAGAGGGAGGG + Intronic
914472432 1:147993418-147993440 CAGGATCAGAAGAGGAGGTGTGG - Intronic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915045349 1:153008854-153008876 CAGGAGAAAGAGTAGAGGGCTGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915321222 1:155057467-155057489 CAGGGCAAGTAGGAGAGGGGTGG - Intronic
915518357 1:156426964-156426986 CAGGACTAGGAGAAAAGGAGTGG - Intronic
915650481 1:157307014-157307036 CAGGAGAAGGAGGAGAGAGCAGG - Intergenic
916412362 1:164559076-164559098 GACGAGAAGGAGGAGAGGGGAGG - Intronic
916524761 1:165598877-165598899 AAGGGAGAGGAGAAGAGGGGAGG + Intergenic
916570012 1:166016980-166017002 CAGGATAAGGGGAGGATGGCAGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918157600 1:181864453-181864475 CAGGAGCAAGAGAAGTGGGGAGG + Intergenic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
918733141 1:188023041-188023063 AAGGATAGGGAGGGGAGGGGAGG + Intergenic
918881554 1:190130530-190130552 TAGGATAAGGGGAAGTGTGGTGG - Intronic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919261043 1:195194430-195194452 CAGAATTAGGAGAAGAGAAGTGG - Intergenic
919473953 1:198011509-198011531 CAGCATAAGCAAAAAAGGGGAGG + Intergenic
919543489 1:198880962-198880984 CAGGATAGAAAGTAGAGGGGAGG - Intergenic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
921052464 1:211520673-211520695 CAGGAAATGGAGAAAAGAGGAGG + Intergenic
921250260 1:213290847-213290869 CAGGATAAGTACAAGACAGGTGG - Intergenic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923051639 1:230394572-230394594 GAGCACAAGGAGAGGAGGGGAGG - Intronic
923051864 1:230395361-230395383 GAGCATGAGGAGAGGAGGGGAGG - Intronic
923051935 1:230395591-230395613 GAGCATGAGGAGAGGAGGGGAGG - Intronic
923096297 1:230777841-230777863 CAGGTTAGGGAGATGAGAGGGGG - Intronic
923345908 1:233052550-233052572 CAGGTTAAGGACCAGAGGAGAGG - Intronic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
1062833815 10:623519-623541 AAGGCCAAGGGGAAGAGGGGAGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1062942054 10:1429884-1429906 CAAGGAAAGGAGATGAGGGGAGG - Intronic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1063426796 10:5956670-5956692 AAGGATGAGGAGCAGAGGTGTGG - Intronic
1063524840 10:6775376-6775398 AAAGATAAGGAGAAGAGAGATGG - Intergenic
1063917880 10:10902959-10902981 GAAGATAAGGAGAAGAAGGGAGG + Intergenic
1064708080 10:18093589-18093611 CCAGATATGGAGAAGAGTGGCGG + Intergenic
1064953640 10:20882241-20882263 AAGGAAAAGGAAAAGAGAGGAGG + Intronic
1065313801 10:24442166-24442188 AAAGATCAGTAGAAGAGGGGTGG - Intronic
1065383244 10:25110714-25110736 CAGGAGAAGGTGTAGAGAGGAGG + Intergenic
1065436380 10:25707481-25707503 CAGCATCAAGAGGAGAGGGGAGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1069366183 10:67696176-67696198 CAGGATAAGAAAGAAAGGGGAGG + Intergenic
1069373033 10:67767147-67767169 AAGGAGAAGGAGGAGAAGGGTGG - Intergenic
1070680553 10:78446086-78446108 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070961889 10:80505251-80505273 CAGCCTCAGGAGGAGAGGGGAGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071464954 10:85931194-85931216 AAGGAGAAGGAGGAAAGGGGAGG - Intronic
1071472358 10:85992600-85992622 GAGGATGAGGAGAGGTGGGGGGG + Intronic
1071588823 10:86851788-86851810 AAGGGTATGGAGGAGAGGGGAGG + Intronic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072494277 10:95940142-95940164 AAGAAGAAAGAGAAGAGGGGAGG + Intergenic
1072767123 10:98104246-98104268 CAGGAAGGGGAGAAGAGGGGAGG - Intergenic
1072848475 10:98859623-98859645 CTGGAAAGGGAGAAGAGGGTTGG - Intronic
1073050649 10:100664949-100664971 CAGGGTAAGGAGGACAGGCGGGG - Intergenic
1073118726 10:101108362-101108384 CAGGATAGGGAGAGGAGGCGGGG - Intronic
1073349698 10:102810877-102810899 GAGGGAAAGGAAAAGAGGGGAGG - Intronic
1073467099 10:103700613-103700635 CAGGGTTAGGGGAAGTGGGGAGG + Intronic
1073581124 10:104666352-104666374 CAGGAGGAGGAGAAGAGGAAAGG + Intronic
1073581230 10:104667365-104667387 CAGGATCAAGAGAGGAGGGCAGG - Intronic
1074119423 10:110482475-110482497 AAGGAAAAAGAGAAGAGGAGAGG - Intergenic
1074204639 10:111272217-111272239 CTGGATGAGAGGAAGAGGGGAGG + Intergenic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074964087 10:118473448-118473470 AAGGAGAGGGAGCAGAGGGGAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075473501 10:122712091-122712113 AAGGATAAGGAGAATGGAGGGGG + Intergenic
1076199280 10:128545470-128545492 GAGGATCAGGAGAACAAGGGAGG + Intergenic
1076271739 10:129158517-129158539 ATGGAGAAGGAGAAGAGAGGTGG + Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076448879 10:130541472-130541494 AAGGAGAAGAAAAAGAGGGGAGG - Intergenic
1076858287 10:133127971-133127993 CAGGAAGAGGTGAAGTGGGGTGG - Intronic
1076934989 10:133561932-133561954 CAGCAAAAGGAAAAAAGGGGGGG + Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1078179583 11:8999887-8999909 CAGGGTAAGGGGAATAGGGAAGG - Intronic
1078520272 11:12057423-12057445 CAGGAGAAAGAGAAAAGGGGAGG - Intergenic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1080301988 11:30794810-30794832 CAGGACAAGGAAAAGAGATGGGG - Intergenic
1080355866 11:31444907-31444929 TAGGAGATGGAGAAGAGGGTTGG + Intronic
1080946179 11:36978109-36978131 CAGGAGGAGGAGAAGAGTTGCGG + Intergenic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081637359 11:44729396-44729418 GGGGGTAGGGAGAAGAGGGGAGG - Intronic
1081841259 11:46203027-46203049 CTGGATAAGGACAAGTGTGGTGG + Intergenic
1082785304 11:57313354-57313376 CAGGACCAGGAGAAGCTGGGGGG - Exonic
1083088907 11:60179785-60179807 CAGGATGGGGCAAAGAGGGGAGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084050438 11:66595988-66596010 CAGGCTAGGGAGAGGTGGGGTGG - Intronic
1084104873 11:66974975-66974997 GAGGAGAAGGAGGAGGGGGGAGG + Intergenic
1084904424 11:72334845-72334867 CTGGAGAGGGAGAGGAGGGGAGG - Intronic
1085018313 11:73189651-73189673 CAGGAGCTGGAGATGAGGGGAGG - Intergenic
1085151849 11:74258653-74258675 TAGCAGAAGGAGAGGAGGGGTGG + Intronic
1085210978 11:74778033-74778055 CAGGAGAAAGAGAACAGGGCTGG - Intronic
1085500955 11:77023313-77023335 TATAATAAGGAGAAGAGGTGTGG + Exonic
1085640506 11:78189761-78189783 AAGGATAAGGAGGAGAGAGAAGG - Intronic
1085773148 11:79342435-79342457 CAGGAGGAGGCGAAGAGGGTGGG + Intronic
1085789332 11:79483427-79483449 CAGGAAACTGAGAACAGGGGAGG + Intergenic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1087048082 11:93860982-93861004 CAGGATAATTTGAAGTGGGGAGG - Intergenic
1087134524 11:94702704-94702726 CAGGAAAGAGAGAAAAGGGGAGG + Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088524219 11:110735221-110735243 GAGGAGAAGCAGAGGAGGGGAGG + Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089625402 11:119747967-119747989 CAGGAAGAGGAGGAGAGAGGTGG + Intergenic
1089739974 11:120575724-120575746 AAGCACAAGGAGAAGAGAGGAGG - Intronic
1089798373 11:121002376-121002398 CAAGAGAAGAAGAAGAAGGGAGG + Intergenic
1090092811 11:123713976-123713998 CTGGATAAGGAGCAGAGCAGTGG - Intergenic
1090173104 11:124622718-124622740 CTGGATGAGGAGAGGAGGGAGGG - Intergenic
1090933328 11:131319403-131319425 AAGGAGAAGGAGGGGAGGGGAGG - Intergenic
1091102503 11:132888094-132888116 GGGAATAAAGAGAAGAGGGGAGG + Intronic
1091124357 11:133082402-133082424 GAGGATAGGGAGGAGAGGAGGGG - Intronic
1091124424 11:133082563-133082585 GAGGATGAGGAGGAGAGGAGGGG - Intronic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091450778 12:570776-570798 GAGGATCAGCAGAAAAGGGGCGG - Intronic
1091600054 12:1912567-1912589 GATGAGAAGGAGGAGAGGGGAGG + Intronic
1092259756 12:6946519-6946541 CAGGAAAAGGACAGGTGGGGCGG - Intronic
1093643886 12:21559965-21559987 CAGGATAGAGAGCAGAGAGGGGG + Intronic
1094083751 12:26566108-26566130 AAGGAGAAGGAGAGGAGGAGAGG + Intronic
1094083846 12:26566546-26566568 AAGGATAAGGAGGAGAGGAGAGG + Intronic
1094085555 12:26587585-26587607 GAGGACAAGGGGAAGAAGGGTGG + Intronic
1094155819 12:27335808-27335830 AAGGAGAAGGGGAGGAGGGGAGG + Intronic
1094727383 12:33133999-33134021 AAGGGTAAGAAGAAGAGGGCAGG + Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095574688 12:43722888-43722910 CAGGATAGGGTGAAGAGTGGAGG - Intergenic
1095837365 12:46653417-46653439 GAGGAAAAGGAGGAAAGGGGAGG + Intergenic
1095979725 12:47964629-47964651 CAGGAAAAGAACAAGAGTGGCGG - Intronic
1096123955 12:49106304-49106326 CAGGAAAGGGAAAAGAGAGGAGG + Intronic
1096379893 12:51147514-51147536 CAGGATAGGAAGAGGTGGGGGGG + Intronic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1099106635 12:78505489-78505511 TAGGATTAGGTGAACAGGGGAGG + Intergenic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100118132 12:91334626-91334648 GAGGAGAGGGAGAAGAAGGGAGG + Intergenic
1100765485 12:97860751-97860773 CTGGAAATGGAGAAAAGGGGAGG + Intergenic
1101128644 12:101666024-101666046 CAGTATCAGGAGAGGAGTGGAGG - Intronic
1101285367 12:103306497-103306519 TAGGAGAAGAAGAAGAGGGGAGG + Intronic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1101580398 12:106037405-106037427 AAGGAAAAGGAGGGGAGGGGAGG - Intergenic
1101768705 12:107728285-107728307 CAGGCTACAGAGATGAGGGGAGG - Intergenic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102976018 12:117207726-117207748 GAGGAGAAGGAGCAGAGAGGAGG - Intergenic
1103119933 12:118372303-118372325 TAGGATAGGGGGATGAGGGGAGG - Intronic
1103582107 12:121923124-121923146 CAGGAAGGGGAGGAGAGGGGAGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1104214821 12:126725424-126725446 CAGGACTAGGAGAGGAGGGGTGG - Intergenic
1104429391 12:128704570-128704592 CAGTGCAGGGAGAAGAGGGGAGG + Intronic
1104498967 12:129266526-129266548 AAGGATAGAGAGGAGAGGGGAGG - Intronic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1104615277 12:130262850-130262872 CAGGATAAGGAACAAAGAGGAGG + Intergenic
1104707442 12:130958083-130958105 CAGGAGAAGGGGAGAAGGGGAGG - Intronic
1105414321 13:20195157-20195179 GAGGAGAAGGAGGAGAGGTGAGG + Intergenic
1106258286 13:28041300-28041322 CTGAAAAAGGAGAAGAGAGGAGG + Intronic
1106301300 13:28468691-28468713 CAGGAACAAGAGAAGGGGGGAGG - Intronic
1106338138 13:28803371-28803393 AAGGATGAGGAGAAGCTGGGCGG + Intergenic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1106533600 13:30618054-30618076 CAGGTAAGGGAGAAGAGGGAGGG + Exonic
1107270726 13:38613063-38613085 TAGGATGATGAGAATAGGGGTGG + Intergenic
1107389071 13:39944555-39944577 GCTGATATGGAGAAGAGGGGTGG - Intergenic
1107897119 13:44976296-44976318 AAGGAGAAGGAGAAGAAAGGAGG + Intronic
1108007512 13:45965279-45965301 CAGGATGAGGAGAAGATGCCAGG - Exonic
1108096504 13:46907375-46907397 AAAGAAGAGGAGAAGAGGGGAGG - Intergenic
1108569922 13:51739563-51739585 CAGCATACGGAAAAGAGGAGAGG + Intronic
1109183882 13:59246818-59246840 GAGGATTAGGAGAAGAGGTTAGG + Intergenic
1109738379 13:66518172-66518194 CAGGAAAAACAGAGGAGGGGAGG + Intronic
1110630960 13:77707898-77707920 CAGGTTGAGATGAAGAGGGGTGG + Intronic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1112837542 13:103534140-103534162 GAGGAGAAAGAGAAGCGGGGAGG + Intergenic
1113062582 13:106339007-106339029 CAGGATGAGAGGGAGAGGGGAGG - Intergenic
1113725508 13:112597139-112597161 CATGATAAGGAAGAGAGTGGTGG + Intergenic
1114388885 14:22284180-22284202 AAGGATTCAGAGAAGAGGGGAGG - Intergenic
1114400022 14:22401653-22401675 CAGGATAAAGAAAGGATGGGAGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1115636613 14:35295981-35296003 CTGGCAAAGGAGAAGAGGAGTGG + Intronic
1115915709 14:38311127-38311149 TAGGATAAGGAGAAGAAATGAGG + Intergenic
1116443467 14:44980971-44980993 CAGGATTAGGAAAAAAGGGATGG + Intronic
1116626568 14:47272436-47272458 CAAGAGAAGAAGAAGATGGGAGG + Intronic
1116774076 14:49159593-49159615 CAGACTAAGGAGAAGAGAAGGGG + Intergenic
1116787581 14:49304383-49304405 CAGGCTAAGCAGAAAAGGAGAGG + Intergenic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117365753 14:55025868-55025890 CAGTATAAAGAGATGAGTGGTGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117649056 14:57883009-57883031 GAGGAGGAGGAGAGGAGGGGAGG + Intronic
1117784002 14:59263698-59263720 CCAGAGAAGGAGAAGAGGAGAGG + Intronic
1118441256 14:65813784-65813806 CAGGATAACGTGAAGTGGTGGGG + Intergenic
1118487191 14:66225102-66225124 CCGGAGAACCAGAAGAGGGGTGG - Intergenic
1118941207 14:70340029-70340051 CCAGTTAAGGAGAACAGGGGAGG - Intronic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119331931 14:73801306-73801328 CAGAATTGGGAGAATAGGGGAGG - Intergenic
1119641225 14:76316398-76316420 TAGGAGCAGGAGCAGAGGGGAGG - Intronic
1121038618 14:90727049-90727071 AAGGAGAAGAAAAAGAGGGGTGG + Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1121777044 14:96598046-96598068 GAGGGGCAGGAGAAGAGGGGAGG - Intergenic
1121917050 14:97844745-97844767 AAGGATAGGGAGAGGAAGGGAGG + Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122081151 14:99268821-99268843 GAGGCAAAGGAGAAGAGAGGTGG - Intronic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1122489101 14:102101493-102101515 CAGCATAAGCAAAAGTGGGGAGG - Intronic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1123707256 15:22959402-22959424 CACGCTCAGGAGAAGAGTGGGGG + Intronic
1124427441 15:29573701-29573723 CAGGAGAAGGAGAGGAAGAGGGG - Intergenic
1124720120 15:32104444-32104466 CAGGATAAAGAGAACAGAGTGGG - Intronic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1127226913 15:56940734-56940756 AAGGAGAAGGAGGAGAAGGGGGG - Intronic
1127394836 15:58536284-58536306 CAGGAGAACGAAAAGAGAGGAGG + Intronic
1127404956 15:58633934-58633956 AAGGAAAAAGAGAAGATGGGTGG + Intronic
1127410948 15:58706590-58706612 AAGGAAAAGGAGAGGAGGAGGGG + Intronic
1127586490 15:60382996-60383018 AAGGATACAGAGGAGAGGGGGGG - Intronic
1128502248 15:68234670-68234692 AATGATAAGGAAAAGAGTGGAGG - Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129980169 15:79861938-79861960 CAGGCTGGGAAGAAGAGGGGTGG + Intronic
1130029368 15:80297754-80297776 GAGGGGAAGGGGAAGAGGGGTGG + Intergenic
1130226096 15:82059155-82059177 AAGGAGAAGGAGAGGAGGGGAGG - Intergenic
1130563813 15:84978845-84978867 CAGGTTTAGTAGAAGAGGTGTGG + Intergenic
1131111977 15:89770163-89770185 CTGGATATGGAGAGGTGGGGAGG + Intronic
1131403573 15:92145679-92145701 CATGAGAAGGAACAGAGGGGCGG + Intronic
1132402893 15:101524399-101524421 GAAGAGAAGGGGAAGAGGGGAGG - Intronic
1132505302 16:305126-305148 CAGGATTTGGAGGACAGGGGAGG + Intronic
1132543600 16:522852-522874 CGGGATTAAGAGAAGAGTGGGGG + Exonic
1132648171 16:1008554-1008576 CCGTATAAGGAGGAGAGGAGAGG - Intergenic
1132713672 16:1280085-1280107 CGGGAGGAGGAGCAGAGGGGAGG + Intergenic
1133421091 16:5647564-5647586 AAGGGAAAGGAGAAGAGGTGGGG - Intergenic
1134310404 16:13070958-13070980 CAGGTCAAGGATAAGAGTGGAGG - Intronic
1134332618 16:13264996-13265018 CAGGAAGAGGAGAGGAGGGAAGG - Intergenic
1134743176 16:16566498-16566520 GAGGAGGAGGAGAAGTGGGGGGG - Intergenic
1134751828 16:16631238-16631260 GAGGAGGAGGAGAGGAGGGGGGG - Intergenic
1134924384 16:18145962-18145984 GAGGAGGAGGAGAAGTGGGGGGG + Intergenic
1135675154 16:24408782-24408804 CAGGAGAAAGAGGAGAGAGGAGG + Intergenic
1135693873 16:24569498-24569520 CAGAAAAAGAAGAAAAGGGGAGG + Exonic
1135821562 16:25691128-25691150 CAGGAGAGGGAGGTGAGGGGTGG + Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1136078843 16:27838502-27838524 CACCATAGGGAGAAAAGGGGAGG + Intronic
1136122207 16:28145351-28145373 CAGGGTGGGGAGAAGAGGAGGGG - Intronic
1136416102 16:30104775-30104797 GAGGGTGAGGAGTAGAGGGGTGG - Intergenic
1137687912 16:50399621-50399643 AGGGATAAGGGTAAGAGGGGAGG + Intergenic
1137725806 16:50655836-50655858 CAGGATAAGGAGGTGAGAGTAGG + Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1139424939 16:66873728-66873750 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1139425012 16:66873917-66873939 GAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1139530427 16:67539942-67539964 TATCATAGGGAGAAGAGGGGTGG + Intronic
1139687134 16:68612762-68612784 CAGGAGGAGGAGAAGAGGAGAGG + Intergenic
1139963498 16:70731377-70731399 CAGGAAAAGGAGGAGAGAGAAGG + Intronic
1140225255 16:73071578-73071600 CAGGATGCAGAGAGGAGGGGAGG + Intergenic
1140511416 16:75511356-75511378 CTGGATTTGGAGAAGAGGAGGGG + Intergenic
1141204158 16:81920468-81920490 CAGGATAGTGTGAAAAGGGGTGG + Intronic
1141584129 16:85021779-85021801 GAGGAGAGAGAGAAGAGGGGAGG + Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1142986509 17:3698250-3698272 CAGGGTAAGGTATAGAGGGGAGG + Intergenic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143174135 17:4947169-4947191 CAGGAAAAGCAGAAGCGGAGAGG + Intronic
1143182541 17:4992647-4992669 AAAGAAAAGGAAAAGAGGGGAGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143749101 17:9015489-9015511 AAGGCTTAGGAGAAAAGGGGTGG - Intergenic
1144116647 17:12100008-12100030 GAGGGAAAGGAGAAGAGGGGTGG - Intronic
1144748488 17:17632059-17632081 GAGGAAGAGGAGAAGAGGGCTGG + Intergenic
1145091131 17:19987020-19987042 AAGGAAAAGGAGAAGAAAGGCGG + Intergenic
1145278989 17:21454965-21454987 AGGGAGAAGGAGAGGAGGGGAGG - Intergenic
1145279001 17:21454994-21455016 AGAGAGAAGGAGAAGAGGGGAGG - Intergenic
1145980169 17:29006329-29006351 CAGGATTGGGTGGAGAGGGGTGG - Intronic
1146572739 17:33967040-33967062 CAGGAAAAGGAGAGTTGGGGTGG - Intronic
1146675846 17:34773360-34773382 CAGGATGAGGAGCTGAGGGTGGG + Intergenic
1146677033 17:34780776-34780798 CAGGATCAGAAGAGGAGGGTGGG + Intergenic
1146956172 17:36937493-36937515 CGGGAGAAGGGAAAGAGGGGAGG - Exonic
1147171203 17:38620092-38620114 CAGGACAAGGAGCAGAGCTGTGG - Intergenic
1147263621 17:39222809-39222831 CAGGATATGGGGAGGTGGGGAGG - Intronic
1147568418 17:41551955-41551977 CAGCATGAGGTGAAGAGGGTGGG + Intergenic
1147740170 17:42666805-42666827 AAGGAGAAGGAGTAGTGGGGAGG - Exonic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148194041 17:45700453-45700475 CAGGATAAGGGGCAGTGAGGAGG - Intergenic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1148396049 17:47309013-47309035 AAAGAAAAGGAGAGGAGGGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149262314 17:54893392-54893414 GAGGATAAAGAGAGGTGGGGAGG + Intergenic
1149345419 17:55729413-55729435 CAGGACAAGGAGTAGATGTGGGG + Intronic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149865670 17:60149850-60149872 CAGGGGAAGGTGGAGAGGGGAGG + Intergenic
1150921266 17:69486111-69486133 CATGTGAAGGAGAAGTGGGGTGG + Intronic
1151150329 17:72079633-72079655 AAGGATGAGAAGCAGAGGGGAGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151329664 17:73399290-73399312 CTGGAAAAGGAGAACAGGGTGGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152720185 17:81919770-81919792 CAGGGGAAGGGGAAGAGGGGTGG + Exonic
1152799306 17:82323537-82323559 CAGGAAAGGGAGGGGAGGGGTGG + Intronic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1153776118 18:8455751-8455773 AAGGACAAAGAGAAGAGGGCAGG - Intergenic
1155045935 18:22103215-22103237 CAGGGTTAGGAAAAGAGTGGGGG - Intergenic
1155085309 18:22452415-22452437 AAGGAAAAGGAGGGGAGGGGAGG - Intergenic
1155399065 18:25418341-25418363 CAGGAAAAGGTGAAAAGTGGGGG - Intergenic
1156270370 18:35525039-35525061 CAGGCCAAGGAGAAGAGGAGAGG - Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157311119 18:46554062-46554084 CAGGATTTGGAGCAGAGGAGTGG + Intronic
1157426978 18:47592477-47592499 GAGGATGAGGAGGAGTGGGGAGG - Intergenic
1157462952 18:47917883-47917905 GAGGATAGGGAGAAGAGGTAAGG + Intronic
1157556156 18:48614044-48614066 AAGGAAAAGGAAAAGAGGGAAGG - Intronic
1157686890 18:49650137-49650159 CAGGACTAGGGGAAGAGGGAAGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159589294 18:70315286-70315308 CAGGAGAAAGAAAAAAGGGGAGG - Intronic
1160379341 18:78439642-78439664 CAGGACAAAGGGAAGAGGGTGGG + Intergenic
1160433250 18:78826834-78826856 CAGCATAAGGAGCAGAGCTGGGG - Intergenic
1160453223 18:78979369-78979391 CAGGGGAGGGAGAGGAGGGGAGG + Intergenic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1161415776 19:4145593-4145615 GAGGGGAAGGAGAAGAGGGAAGG + Intergenic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162204212 19:9043682-9043704 CAGAATGAGTGGAAGAGGGGAGG - Intergenic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162557586 19:11397198-11397220 CAGGATAGGGGGCAGCGGGGAGG - Intronic
1162690495 19:12425983-12426005 AAGGGAAAGGAGAGGAGGGGAGG + Intronic
1163199020 19:15749216-15749238 CAGGAGGAGGAGAGGAGAGGTGG - Intergenic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1164147411 19:22520440-22520462 AAGGAAAAGGAAAAGCGGGGAGG - Intronic
1164234849 19:23323094-23323116 GAGGAAAAGGAGACAAGGGGAGG - Intronic
1164302417 19:23973502-23973524 GAGGAGGAGGAGAAGAGAGGAGG + Intergenic
1164324470 19:24179759-24179781 CAGGAAAAGGGGAGGAGGAGGGG + Intergenic
1164531861 19:29054976-29054998 CAGGATGAGGAGTGGAGGTGGGG - Intergenic
1164537236 19:29094956-29094978 CAGGATGAGATGAACAGGGGTGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165730801 19:38143418-38143440 CAGGGAAAGGAGGAGAGGGTGGG - Intronic
1165793588 19:38506276-38506298 GAGGACAAGGGGAAGATGGGAGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166190900 19:41175925-41175947 CAGGGGGAGTAGAAGAGGGGTGG - Intergenic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166366705 19:42281614-42281636 GTGGATTAGGAGCAGAGGGGAGG - Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166721984 19:45002008-45002030 CCAGAGAGGGAGAAGAGGGGCGG + Intronic
1167112024 19:47468212-47468234 GAGGCTGAGGAGCAGAGGGGAGG - Intronic
1167381809 19:49142639-49142661 CAGGACAAGGAAAAGAGACGTGG - Intronic
1167490783 19:49791855-49791877 GAGGAACAGGAGAGGAGGGGAGG + Intronic
1168156752 19:54477777-54477799 CAGGATATTGAGAGGAGAGGAGG + Intergenic
925800303 2:7592347-7592369 CAGGAGATGAAGGAGAGGGGTGG - Intergenic
925828313 2:7872553-7872575 CAGGAAAAGGGGTAGAAGGGAGG - Intergenic
926064677 2:9828672-9828694 AAGGGAAAGGAGAGGAGGGGAGG + Intergenic
926650084 2:15334171-15334193 AAGAAAAAGGAGAAGAGAGGAGG - Intronic
926976927 2:18524803-18524825 CTGGATAAGGATAACATGGGAGG + Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927487631 2:23499589-23499611 GAGGCTAAGGAGAAAAGGGATGG + Intronic
927884555 2:26710479-26710501 CAGGCTTCAGAGAAGAGGGGAGG + Intronic
928050404 2:27988197-27988219 CAGGACAGAGAAAAGAGGGGTGG - Intronic
928268262 2:29831040-29831062 GAGGAGAAGGAGAAGAGGAAGGG + Intronic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
929084911 2:38158576-38158598 CAGGATGTGGAGAGGTGGGGAGG - Intergenic
929242530 2:39666549-39666571 AAGGAGAGGGAGAAGAAGGGAGG - Intronic
929244482 2:39686671-39686693 CAGGATGGGGAGAAGATGGGGGG + Intronic
929431160 2:41887842-41887864 CTGGACAATGAGATGAGGGGAGG + Intergenic
929444425 2:41991766-41991788 CAGGAGAGGGAGGGGAGGGGAGG + Intergenic
929853441 2:45614048-45614070 CGGGAGAAGGTGGAGAGGGGAGG - Intergenic
930298273 2:49582225-49582247 TAGGCTAAGGAGAAGAGAAGGGG + Intergenic
931244897 2:60484334-60484356 GAGGAAAAGGGGAAGAGAGGAGG - Intronic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
932278558 2:70470163-70470185 AAGGAACAGAAGAAGAGGGGAGG + Intronic
933072860 2:77883183-77883205 CAGGAGAAGGAATAGAGGGATGG - Intergenic
933306856 2:80611299-80611321 AAAGATAAGGAGGGGAGGGGAGG + Intronic
933321337 2:80779310-80779332 CAAGAAAAGAAGAAAAGGGGTGG - Intergenic
934101664 2:88659293-88659315 CAGCACTAGGAGAAGAGTGGAGG - Intergenic
934274997 2:91567742-91567764 CAGGATCAGGACAAGAGGCAGGG + Intergenic
934904859 2:98190941-98190963 TAGAAGAAGGAGAAGAGAGGGGG - Intronic
935006552 2:99084435-99084457 CAGGAGCAAGAGAAAAGGGGAGG - Intronic
935832138 2:107011312-107011334 CAGGATAATGTGAGGAAGGGCGG - Intergenic
936037127 2:109122095-109122117 CAGGATGAGGAGAACAGATGTGG + Intergenic
936169669 2:110157641-110157663 CTGGATATGGAGGAGAGAGGAGG - Intronic
936521266 2:113213310-113213332 GGGGAGAGGGAGAAGAGGGGAGG + Intergenic
936521276 2:113213338-113213360 GGGGAGAGGGAGAAGAGGGGAGG + Intergenic
936655532 2:114481933-114481955 GAGAAGAAGGAGAAGAGAGGAGG + Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936985507 2:118308677-118308699 GAGGAGTAGGAGAAGAGGGAGGG + Intergenic
937037765 2:118795937-118795959 CAGTTTAAGGAGAAAAGGTGGGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937520109 2:122703381-122703403 AAGGAGAAGAAAAAGAGGGGAGG + Intergenic
937641553 2:124217595-124217617 CAGGATAAGGTGAAGTGGAGGGG - Intronic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938709829 2:133966656-133966678 TATGATAAGGAGAAGAGAGAGGG - Intergenic
938946433 2:136216560-136216582 CAGGCTGAGGAGATGAGGTGTGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941013238 2:160325204-160325226 AAGAGTAAGGAGATGAGGGGTGG + Intronic
941038203 2:160590533-160590555 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
941622119 2:167789918-167789940 AAGAATAAGGACAAGAGGAGTGG - Intergenic
941951416 2:171160572-171160594 GAGGAAACCGAGAAGAGGGGAGG + Exonic
942247781 2:174023741-174023763 CAGGAGAAGGAGGGGTGGGGAGG + Intergenic
943124305 2:183777396-183777418 CAGGATTACTAGATGAGGGGAGG - Intergenic
943540083 2:189202763-189202785 AAGGATGAGGATAAGAGGGCAGG + Intergenic
943557167 2:189419910-189419932 GAGGAGAAGAAGGAGAGGGGAGG + Intergenic
943699844 2:190977808-190977830 CAGGATAAGAGGAAAAGGGCAGG + Intronic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945557601 2:211298650-211298672 CAGGTCAAGGACCAGAGGGGAGG + Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
945994460 2:216424426-216424448 CAGGATTAGGAGAAAAGCAGAGG - Intronic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948187488 2:236032914-236032936 CAGTATACGGAGAAGACAGGTGG + Intronic
948266460 2:236638583-236638605 AAGGGGAAGGAGAAGAGGTGAGG + Intergenic
948311911 2:236993784-236993806 GAGGATAGCGAGAAGAGTGGAGG + Intergenic
948336343 2:237210370-237210392 CAGGATAATTAGAGGAGGGACGG - Intergenic
948349937 2:237331375-237331397 TAGGAGAAGGTGAGGAGGGGAGG + Intronic
948538967 2:238672217-238672239 GAGGAGAAGGAGGAGGGGGGAGG - Intergenic
948664772 2:239528095-239528117 CAGGATGGGGAGAACAGGGATGG - Intergenic
948841124 2:240649562-240649584 CAGGACAGGCTGAAGAGGGGCGG + Intergenic
948863278 2:240763160-240763182 CAGGAGATGGAGCAGAGGTGAGG - Exonic
948922805 2:241073640-241073662 GAGGCGAAGGAGGAGAGGGGAGG - Intronic
948939204 2:241187764-241187786 GAGGAGAGGGAGAAGTGGGGGGG + Intergenic
948939253 2:241187931-241187953 GAGGAGAAGGAGGAGAGGGAAGG + Intergenic
1168770190 20:409410-409432 CAGGTTAAGGAGACCAGGGGAGG - Intronic
1168806018 20:672786-672808 AAGGAGAAAGAGAGGAGGGGGGG - Intronic
1168813902 20:723728-723750 GAGGAGAAGAAGAGGAGGGGAGG - Intergenic
1168813903 20:723731-723753 CAGGAGGAGAAGAAGAGGAGGGG - Intergenic
1168953664 20:1819551-1819573 CAGGCGAAGGAGAGGAGGTGGGG - Intergenic
1169195671 20:3680988-3681010 CAGGATAGGGCTCAGAGGGGAGG + Intronic
1169300329 20:4436625-4436647 TAGGGTAAGCAGAAAAGGGGAGG - Intergenic
1170197001 20:13699540-13699562 CAGGAAACAGAGATGAGGGGAGG + Intergenic
1171077446 20:22142947-22142969 AAGGAAAAGGAGAAGAGGATGGG - Intergenic
1172017920 20:31889928-31889950 CAGGACAGGAAGAAGAGGGGAGG + Intronic
1172281345 20:33710297-33710319 TAGGAGTAGGAGAAGAGGTGTGG - Intronic
1172411297 20:34725396-34725418 GACGTTAAGGAGAAGAGAGGTGG + Intronic
1173178595 20:40784274-40784296 CAGGCTATGGTGAAGAGGGAGGG - Intergenic
1173572678 20:44087687-44087709 CAGGATATGGGGAAGATAGGAGG - Intergenic
1174776266 20:53345783-53345805 CAGGATGCTGAGAAGTGGGGAGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175311468 20:58014658-58014680 CAGGAGAAAGAAGAGAGGGGAGG + Intergenic
1176071048 20:63226602-63226624 GAGGAGAAGGAGGAAAGGGGTGG - Intergenic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176362081 21:6006218-6006240 GAGGAGGAGGAGAGGAGGGGGGG + Intergenic
1176379051 21:6102562-6102584 CAGGATAACGAGCAGTTGGGCGG - Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176740301 21:10595521-10595543 CAGGAACAAGAGAAGAGGGATGG + Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177807298 21:25886777-25886799 CACGATAAGGAAAAGTGAGGGGG - Intronic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178210638 21:30527417-30527439 CTGGATTAGGAGGAGAGCGGTGG - Intergenic
1178433629 21:32537737-32537759 TAGGATCAGGAGAAGAAGGGAGG + Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179136099 21:38681353-38681375 CAGGATCGAGAGAAGGGGGGAGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179594034 21:42430429-42430451 CAGGGTAAGGAAGAGAGGTGAGG - Intronic
1180228849 21:46414376-46414398 GAGGAGAAGGAGGAGAAGGGTGG - Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1183108343 22:35630316-35630338 GAGGGGAAGGAGAAGAGGAGGGG + Intronic
1183470457 22:38003139-38003161 TAGGATGTGGAGAACAGGGGAGG + Intronic
1183635770 22:39061574-39061596 CAGCCTGAGGAGAAGAGGAGAGG + Intronic
1183782473 22:40007584-40007606 GAGGAGGAGGAGAAGAGAGGAGG - Intronic
1184100046 22:42337246-42337268 GAGGATAAGGGGGAGAGGAGTGG - Intronic
1184286851 22:43476811-43476833 AAGGACAAGGAGAGGAGGGGAGG + Intronic
1184394691 22:44226212-44226234 CAGGAGAAAGTGAAGGGGGGTGG - Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184709407 22:46239671-46239693 CAGGAAGAGGTGAAGAGGAGAGG - Exonic
1185399334 22:50607850-50607872 CAGGGTGAGGGGAGGAGGGGAGG + Intronic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949284361 3:2383672-2383694 AAGGATAGGGAGAGGAAGGGAGG - Intronic
950287317 3:11755115-11755137 CAGGATGAGGGGAGGAGGGGAGG - Intergenic
950591038 3:13935818-13935840 CAGGAGGAGGAGAGGAGGAGGGG + Intergenic
951055791 3:18145247-18145269 CAGGCAAAGGAGAGAAGGGGAGG - Intronic
951639341 3:24817788-24817810 CAAGAAGAGGAGAAAAGGGGTGG - Intergenic
952276898 3:31886029-31886051 AAGGAGAAGGAGATGGGGGGTGG + Intronic
952405500 3:33001166-33001188 AAGGAGAAGGAGAAGAGGAGAGG - Intronic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
952963663 3:38608114-38608136 CAGGACAAGGAGACCCGGGGTGG + Intronic
953134078 3:40167699-40167721 CAGGCTAGGGAGAAGTGTGGTGG - Intronic
953369350 3:42374145-42374167 CAAGATAAGGAGCAGATGGAAGG - Intergenic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
954117713 3:48476397-48476419 CAAAATAAGGAGAGGAGGAGGGG + Intronic
954157547 3:48694951-48694973 GAGGAGAAGGAGGAGAGGGAGGG + Intronic
954328991 3:49879134-49879156 CAGCATCAAGGGAAGAGGGGTGG - Intergenic
954444117 3:50537443-50537465 CAGGAACTGGAGAAGAGGTGGGG + Intergenic
954621232 3:51996804-51996826 GTGGAGAAGGAGCAGAGGGGAGG + Intergenic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
956545637 3:70399139-70399161 CAGCAAAAGGAGAAAAGAGGAGG - Intergenic
956728013 3:72172414-72172436 AGGGAGAAGGAGGAGAGGGGAGG + Intergenic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957954166 3:87162091-87162113 GAGGATAAAGGGAGGAGGGGTGG - Intergenic
958973589 3:100640360-100640382 TAGTATAGGGAGAAGAGGAGAGG + Intronic
959186185 3:103050619-103050641 AAGGAAAAGGAGGAGAGGTGAGG + Intergenic
959574925 3:107924496-107924518 CAGGATCAGGAGAACAGCGCTGG + Intergenic
960628302 3:119702895-119702917 CAGGGTCAGGAGGAGAGTGGAGG - Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
960854119 3:122085669-122085691 CAGGATGAGGGGAGGTGGGGTGG + Intronic
961101809 3:124205881-124205903 CAGAATAATGAGCACAGGGGAGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962403505 3:135081089-135081111 CAGGTGAAGGAGGGGAGGGGAGG + Intronic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
964383328 3:156120493-156120515 CAGGATAAGGTTAAGAGAGGTGG + Intronic
964590696 3:158360246-158360268 GAGGATGAAGAGAAGATGGGAGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965670475 3:171142590-171142612 CAGGAAAAGTAGGAGTGGGGTGG + Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966304246 3:178513123-178513145 CAGGAGGAGGAGCGGAGGGGGGG - Intronic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
966945441 3:184774143-184774165 CAGGAAAGGGAAAAGAGTGGAGG + Intergenic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967283995 3:187850887-187850909 TAGGGGAAGGAGGAGAGGGGTGG + Intergenic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
968997604 4:3955534-3955556 CAGGGTCAGGAGGAGAGTGGTGG + Intergenic
969016713 4:4108165-4108187 GAGGCCAAGGAGAAGAGCGGGGG + Intergenic
969325514 4:6441716-6441738 CTTGATAAGGAATAGAGGGGTGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970491595 4:16580846-16580868 CAATATAAAGAAAAGAGGGGTGG - Intronic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971112377 4:23602763-23602785 GGAGATAAGGAGAAGAGGGGAGG + Intergenic
971181404 4:24331409-24331431 CAGGATAAGGAGATGGTGAGTGG - Intergenic
972980949 4:44700489-44700511 CAGGACAACTTGAAGAGGGGCGG - Exonic
973288023 4:48441140-48441162 CAGGAGAAGGAGAAGTGCGTGGG - Intergenic
973836911 4:54819023-54819045 TAGGAAGAGGAGAAGAGGGGAGG - Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974430895 4:61794308-61794330 CAAGATAAGGACATGAGTGGAGG + Intronic
975324383 4:73043029-73043051 CAGGATAATGTCAAGAGGGGAGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976799141 4:88968705-88968727 CTGGATATGGAGAACAGGGCAGG - Intronic
976957677 4:90922293-90922315 GGGGAAAAGGAGAAGAGGGAAGG + Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
978089545 4:104697935-104697957 GAGTATAAGGAGAAGAAAGGGGG + Intergenic
978323357 4:107522960-107522982 CTGGCTAAGGAAAAGAGGAGTGG - Intergenic
978344306 4:107750672-107750694 GAGGAGAAGGAGAAGAGAAGAGG - Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
979396108 4:120191564-120191586 TAGGACAAGGGGAAGAGGGAAGG - Intergenic
979885803 4:126025855-126025877 CAGGATAAAGAGAAAAGGTGGGG - Intergenic
980451547 4:132979901-132979923 GAGGAATAGGGGAAGAGGGGAGG - Intergenic
980522651 4:133952755-133952777 TAGGATTAGGAGTAGAGGAGGGG - Intergenic
981619347 4:146676402-146676424 GAGGAGAAGGAGGAGAGGGTGGG - Intergenic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
982217342 4:153093984-153094006 CAGGCTGAGGAGAGCAGGGGAGG - Intergenic
983026708 4:162746800-162746822 CAGGAAGGGGAGGAGAGGGGAGG + Intergenic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983772750 4:171571260-171571282 CAGGAAAAGGACAAGAGATGGGG + Intergenic
984703609 4:182833513-182833535 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
984703681 4:182833712-182833734 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
984703897 4:182834320-182834342 GAGGAGAAGGAGGGGAGGGGAGG - Intergenic
985250265 4:188016858-188016880 CGGGATAAGGAGGAGAGAGGAGG + Intergenic
985703541 5:1387623-1387645 CAGGAGAAGGAGAGCAGGCGAGG + Intergenic
985785247 5:1889889-1889911 CAGGATACGGAGCAGAGGCCAGG - Intergenic
986496962 5:8352244-8352266 CAAGCTAGAGAGAAGAGGGGAGG + Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
987142241 5:14958241-14958263 TAGAATAAGGAGGGGAGGGGAGG - Intergenic
987339047 5:16923044-16923066 AAGGAAAAAGAGAAGAGGGGAGG + Intronic
987851182 5:23356954-23356976 CAGGATGAGGAGAAAAGTGAAGG + Intergenic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
995160584 5:108975915-108975937 CAGGTTAAGGAGAAAATTGGGGG + Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
996188166 5:120505109-120505131 AAGCAGAAGGAAAAGAGGGGAGG - Intronic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996479016 5:123952240-123952262 CTGGATCAGGAGTAGAGGGGTGG - Intergenic
998225393 5:140322811-140322833 AAGCAGAGGGAGAAGAGGGGTGG - Intergenic
998561009 5:143171496-143171518 CATCACAAGGAGGAGAGGGGAGG + Intronic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
999295699 5:150458334-150458356 CAGGACAGGAAGAAGAGGGTGGG + Intergenic
999622888 5:153490441-153490463 GAGGATAAGGTGAGGATGGGAGG + Intronic
999848501 5:155511888-155511910 CCGGATGAGGAGAAAAGTGGTGG - Intergenic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
1000185222 5:158851847-158851869 AGGGAAAAGGAGAAGAGGGGAGG + Intronic
1000606288 5:163331048-163331070 AAGGATAAGGACAAGAGGGAGGG + Intergenic
1001045841 5:168370998-168371020 CAGGATAAGGATTAGAGGTGGGG + Intronic
1001189547 5:169615697-169615719 CAGGAGAGGGAGAAGAGTGAAGG - Intergenic
1001677095 5:173528094-173528116 CAGGACGAAGAGAAGAGGAGAGG - Intergenic
1001722730 5:173869874-173869896 GGGGAAAAGGAGAAGATGGGTGG - Intergenic
1002531971 5:179852597-179852619 TAGGATACTGAGAAGAGGGAGGG + Intronic
1004013183 6:11708898-11708920 AAGGAGAAGGAGATGAGGAGTGG - Intergenic
1004284821 6:14311588-14311610 CAGGGTGAGGCGAAAAGGGGAGG - Intergenic
1004738315 6:18430816-18430838 AAGGATAAGGAGAACAAAGGAGG - Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005089185 6:22038490-22038512 GAGGAGAAGGAGAGGAGAGGAGG - Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005864027 6:29925077-29925099 TAGGAAAAGGAGCAGAGGGAAGG + Intergenic
1005987441 6:30883789-30883811 GAGGAGAAGGAGAAGAGAGTGGG + Intronic
1006078104 6:31547397-31547419 GAGGAAAAGGAGGCGAGGGGAGG - Intronic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006114830 6:31769970-31769992 CAGGAAACGGGGAAGAAGGGAGG + Intronic
1006151628 6:31993022-31993044 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006157929 6:32025760-32025782 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006182895 6:32164560-32164582 CAGGCTAAGAAGGAGAGGAGGGG - Exonic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006676089 6:35764720-35764742 TGGGACAAGGAGAAGAGGGCGGG + Intergenic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1006934066 6:37705357-37705379 AAGGAGAAGGGGAGGAGGGGCGG + Intergenic
1007053345 6:38856101-38856123 AAGGGTAAGGAGAAGAGGATAGG - Intronic
1007303530 6:40886878-40886900 GAGGAGAGGGAGAAGAGGAGAGG + Intergenic
1007689440 6:43689750-43689772 TAAGATAATGAGAAGAGGGTTGG - Intergenic
1007766613 6:44164327-44164349 CAGGATAGGGAGTAGGGGAGGGG + Intronic
1008479294 6:51968383-51968405 CAGGAAAAGAAGAAAAGGGAGGG - Intronic
1008497977 6:52152238-52152260 AAAGAAAAGGAGAGGAGGGGAGG + Intergenic
1009771267 6:68145467-68145489 GAGGATAAGGAAGAGAGGAGAGG - Intergenic
1011111252 6:83838844-83838866 AAGGACAAAGAGAAGAGGAGTGG + Intergenic
1011763623 6:90594900-90594922 GAGGATAAAGAGATGATGGGAGG + Intergenic
1012335716 6:98054401-98054423 CAGGATTAGCAGAACAGGGTGGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013630885 6:111984725-111984747 GAGGCTCAGGAGGAGAGGGGAGG + Intergenic
1014074660 6:117222434-117222456 CTGGAAGAGGAGAATAGGGGAGG - Intergenic
1014243467 6:119042233-119042255 CAGGATAATGGGAAGAAAGGGGG + Intronic
1014727720 6:124992566-124992588 TAGAATAGTGAGAAGAGGGGAGG + Intronic
1015368687 6:132425828-132425850 AAAGAAAAGAAGAAGAGGGGAGG - Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016781393 6:147963380-147963402 CAGAATGAGGAGAAAAGGGTAGG - Intergenic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017243654 6:152197999-152198021 CAGGAAGGGGAGAGGAGGGGAGG + Intronic
1017637313 6:156456097-156456119 GAGGACAAGGGGAGGAGGGGGGG - Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1017875564 6:158521520-158521542 CAGAAAAAGAAGAGGAGGGGAGG + Intergenic
1018900514 6:168049680-168049702 CAGGCTCAGGAGAGGAGAGGAGG + Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1019535276 7:1526114-1526136 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535300 7:1526201-1526223 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535324 7:1526287-1526309 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1020370165 7:7423197-7423219 CAGGATAATGTGGTGAGGGGAGG + Intronic
1021153989 7:17186777-17186799 CAGGATAAGGAGATGATCTGAGG - Intergenic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021777833 7:24071225-24071247 GAGGAAAGGGAGGAGAGGGGAGG - Intergenic
1021871254 7:25008507-25008529 GAGGATAAGGAGGAGAGGAAAGG + Intergenic
1022370280 7:29764800-29764822 CAGGGTTAGGAGGAGAGTGGGGG - Intergenic
1022466134 7:30654295-30654317 CTGGATGAGAAGAAGAGAGGGGG - Intronic
1022802052 7:33786145-33786167 GAGGAGCAGGAGAAGAGAGGAGG + Intergenic
1022996161 7:35757541-35757563 GAGGAAAAGGAGAAGAAAGGGGG - Intergenic
1023064859 7:36367076-36367098 CAGGATAAGGAGGGTAAGGGCGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1023910031 7:44547259-44547281 CAGGATGGGGAGGGGAGGGGAGG + Intergenic
1024080908 7:45854089-45854111 CGGGAAGGGGAGAAGAGGGGAGG + Intergenic
1024589503 7:50868762-50868784 ATGTATAGGGAGAAGAGGGGTGG + Intergenic
1024813564 7:53241675-53241697 AAGGAGAAGGAGAAGAGAAGGGG - Intergenic
1024937194 7:54722431-54722453 CAGGGTAAGAAGGAGAGTGGAGG - Intergenic
1025123597 7:56327750-56327772 CGGGAAGGGGAGAAGAGGGGAGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1025937510 7:66049011-66049033 CAGGAGCAAGAGAGGAGGGGAGG + Intergenic
1025946529 7:66109051-66109073 CAGGACCAAGAGACGAGGGGAGG - Intronic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026808575 7:73443581-73443603 TTGGTTAAGGAGCAGAGGGGAGG + Intronic
1026848806 7:73712273-73712295 CAGGATAAAGAGCAGAGCTGGGG - Intronic
1027671789 7:81109299-81109321 GAGGAGAAGGAGAAGAGCAGGGG + Intergenic
1027856230 7:83515167-83515189 AAGGAAAAGGAGGAGAGGAGGGG - Intronic
1028775467 7:94671172-94671194 GAGGATAAGGAGTAAAGGGTGGG - Intergenic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1029803014 7:102969812-102969834 AAGGAAAGGGAGGAGAGGGGAGG + Intronic
1030186110 7:106763845-106763867 GACGACAAGGAGGAGAGGGGAGG - Intergenic
1030272356 7:107684356-107684378 CAGGAAAGGGAGTGGAGGGGAGG + Intronic
1030272512 7:107685613-107685635 CAGGAAAGGGAGTAGAGGGAAGG - Intronic
1031461135 7:122050451-122050473 AGGGAAAAGGAGAGGAGGGGAGG + Intronic
1031810185 7:126357869-126357891 CAGGATTAAGTGAAGAGTGGAGG - Intergenic
1031988260 7:128177933-128177955 GAAGAAAAGGAGAAGTGGGGAGG + Intergenic
1032419612 7:131767579-131767601 CAGGAGCAAGAGAGGAGGGGAGG + Intergenic
1032572247 7:133012773-133012795 AAAGAAAAGGAGGAGAGGGGAGG + Intronic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1032936724 7:136740885-136740907 AAAGAGAAGGAGAGGAGGGGAGG - Intergenic
1032955140 7:136961862-136961884 GAGGAGAAGGAGACGTGGGGAGG + Intronic
1033047761 7:137977945-137977967 AAGGAAAAGGAGGGGAGGGGAGG + Intronic
1034081923 7:148287077-148287099 CCGGGCAAGGAGCAGAGGGGAGG - Intronic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1034562507 7:151890311-151890333 CAGGAGAAGGAGCAGAGGAAGGG - Intergenic
1034679213 7:152915829-152915851 GAGGAGGAGGAGATGAGGGGAGG - Intergenic
1034733198 7:153405753-153405775 AAGGAGAGTGAGAAGAGGGGAGG - Intergenic
1034952992 7:155313543-155313565 CAGAATGAGGAGAAAAGGGGAGG - Intergenic
1035160593 7:156947604-156947626 CAGGGTCAGGAGATGAGGTGAGG + Intergenic
1035574543 8:696384-696406 GTGGAGAAGGAGAAGAGTGGAGG - Intronic
1035574610 8:696683-696705 GTGGAGAAGGAGAAGAGTGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036193120 8:6689536-6689558 GAGGAAAAGAAGAAGAGGGATGG - Intergenic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1036935994 8:13003396-13003418 CAGGATAAGGGCAACAGGGAAGG - Intronic
1037360846 8:18071947-18071969 CAGGAAAATGAGAAGAGAAGAGG - Intronic
1037915185 8:22768722-22768744 CAGGATGGGGAGAGGAGTGGGGG + Intronic
1038120391 8:24607973-24607995 GAGGAAAAGGAGAAGGGGAGGGG + Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039751902 8:40486341-40486363 GAGGAGAAGGAGAAGAGGAAGGG - Intergenic
1040026389 8:42786171-42786193 GAGGAAAAGGAGGAGAGGGGAGG + Intronic
1040690969 8:49937956-49937978 TAGGATAAAGAAAAGAAGGGAGG - Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041715024 8:60924644-60924666 CAGGATGGGGAGGGGAGGGGAGG - Intergenic
1043148278 8:76682289-76682311 CTTGAGAAGGGGAAGAGGGGCGG - Intronic
1043472812 8:80578676-80578698 GAGGAGAAGGAGAACAGGGGAGG - Intergenic
1044014161 8:87030840-87030862 GAGGAGAGGGAGGAGAGGGGAGG - Intronic
1044014171 8:87030868-87030890 GAGGGGAAGGAGGAGAGGGGAGG - Intronic
1044043123 8:87395357-87395379 CAAGTTATGGAGAAGAGGGAAGG + Intronic
1044894914 8:96881347-96881369 CAGGAGCAGGAGCAAAGGGGAGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045008530 8:97937028-97937050 CTGGAGAAGGAGAGGAGTGGAGG - Intronic
1045056518 8:98372754-98372776 CAGGATAATGAGAAGAGCATGGG + Intergenic
1045491308 8:102671357-102671379 CAGGAGGAGGATCAGAGGGGAGG - Intergenic
1045728713 8:105207850-105207872 AAGGATATGGAGAAAAGGGGAGG + Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046962726 8:120127082-120127104 CAGGTTAGGGAGAAATGGGGAGG - Intronic
1047468532 8:125144033-125144055 CGTGATAGGGAAAAGAGGGGGGG + Intronic
1047767783 8:128003338-128003360 AAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1048461301 8:134623764-134623786 GAGGGCAGGGAGAAGAGGGGAGG - Intronic
1048472833 8:134718702-134718724 AAGGATAAGGGGTAGAGGGAGGG + Intergenic
1049199515 8:141333215-141333237 CAGGTGAAGGAGGAGATGGGTGG + Intergenic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050009989 9:1175634-1175656 CAACATAAGGAGAAAAGGTGAGG - Intergenic
1050140209 9:2509995-2510017 CAGCAAAGGGAGAATAGGGGCGG - Intergenic
1050344922 9:4676856-4676878 AAGGAAAAGGAGGGGAGGGGAGG - Intergenic
1050601766 9:7259900-7259922 CAGGAGAAGTTGAAGAGGTGAGG + Intergenic
1050797526 9:9562766-9562788 GGGGATAAGGAGATGTGGGGTGG - Intronic
1051264632 9:15298853-15298875 CGGGATAAGGTGCAGAGGTGAGG - Intronic
1051323437 9:15936635-15936657 CAGGTTAAGGGGAGGTGGGGAGG - Intronic
1051368670 9:16339725-16339747 CAGGACAAGACTAAGAGGGGTGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052629505 9:31019213-31019235 AGGGAAAAGGAGAGGAGGGGAGG + Intergenic
1052738437 9:32369654-32369676 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1052857177 9:33414766-33414788 CAGGAGAAGGACAGGAGGTGTGG - Intergenic
1053105730 9:35406323-35406345 CAGGATAGGGGCAAGGGGGGCGG - Intergenic
1054914795 9:70485846-70485868 AAGGATGGGGAGAAAAGGGGAGG - Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055568848 9:77595952-77595974 CAGGATAAGGAGAATAGAGATGG + Intronic
1056233929 9:84573122-84573144 AAGGAAAAGGAGAGAAGGGGAGG - Intergenic
1056477952 9:86971032-86971054 GAGGAGAAAGAGAAGAGGAGGGG + Intergenic
1057289284 9:93790849-93790871 CAGGAAAAAGTGAAGAGGGGAGG + Intergenic
1057842138 9:98494990-98495012 CAGGGTTGGGAGAGGAGGGGAGG - Intronic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1059138406 9:111829512-111829534 GAAGATAAGGAGAAGAAGGGAGG - Intergenic
1059404870 9:114093305-114093327 CAGGGGCAGGAGTAGAGGGGTGG + Exonic
1059542524 9:115144377-115144399 GAGGAAAAGGAGAAGGGGAGGGG - Intronic
1060546515 9:124465098-124465120 CAGGTGAAGGGGCAGAGGGGAGG - Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061366901 9:130176941-130176963 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
1061477172 9:130875822-130875844 AAGGAGAAGGAGAAGAGAGGAGG - Intronic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1061729413 9:132601968-132601990 CACGAAAAAGAGAAAAGGGGAGG + Intronic
1062408983 9:136412051-136412073 CAGGTAAGGGAGAAGAGAGGGGG - Exonic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1185661981 X:1735376-1735398 CAGGATAAGAAGAAAGGAGGAGG - Intergenic
1185688325 X:1948435-1948457 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185688603 X:2133957-2133979 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1186242138 X:7580463-7580485 AATGATAAAGAGAAGAGTGGAGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187067489 X:15854818-15854840 CAGGCTTAGGCGGAGAGGGGAGG + Exonic
1187242939 X:17530210-17530232 CTGGAGAGGGAGAGGAGGGGAGG - Intronic
1187509100 X:19901519-19901541 CAGGACAAGGAGAACAGGAGAGG + Intergenic
1187543798 X:20227135-20227157 CAGGATTGGGGGAAGAGGTGGGG - Intronic
1188798745 X:34500114-34500136 GAGGATATGGGGAAGAGCGGAGG + Intergenic
1188924009 X:36016800-36016822 GAGGATACGGAGAAAAGGGAAGG - Intergenic
1189284483 X:39841559-39841581 AAGGAGAGGAAGAAGAGGGGAGG + Intergenic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1189615463 X:42778689-42778711 CAAGACAGGGAGAAGAGAGGAGG - Intergenic
1189777104 X:44480263-44480285 CAGGAGAAGCAAAAGATGGGAGG - Intergenic
1190179213 X:48177475-48177497 GAGGAGAGGGAGAGGAGGGGAGG + Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1191962385 X:66718283-66718305 TATAAGAAGGAGAAGAGGGGTGG + Intergenic
1192042318 X:67635538-67635560 CAGGAGGAGGAGCAGAGGAGAGG + Intronic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192244973 X:69364509-69364531 GAGGAGCAGGGGAAGAGGGGAGG - Intergenic
1192274360 X:69615122-69615144 CAGGAGAAGGATGGGAGGGGTGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1197651590 X:129071503-129071525 CAGGAAAAAGAGAAAAGGGTGGG + Intergenic
1198467529 X:136917003-136917025 GAGGAGAAGGAGAAGAGGAAGGG - Intergenic
1198467552 X:136917123-136917145 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
1199053114 X:143260878-143260900 AAGAATAATGAGAAGAGGCGGGG + Intergenic
1199443223 X:147892796-147892818 AAGGATAAGGAGACGAAGGTAGG - Intergenic
1199650776 X:149944771-149944793 GAGGAGAAGGAGAGGAGGGGGGG + Intergenic
1199714390 X:150495956-150495978 CAGGATAGAGAGAATAGGAGAGG - Intronic
1199901535 X:152177361-152177383 GAGGATAAGGATAAGAAGTGAGG + Intronic
1199982934 X:152930759-152930781 CAGGATCAAGGGAGGAGGGGTGG + Intronic
1200049848 X:153422971-153422993 AGGGCTAAGGGGAAGAGGGGTGG - Intergenic
1200338034 X:155372747-155372769 AGGGAAAAAGAGAAGAGGGGAGG + Intergenic
1200348435 X:155467947-155467969 AGGGAAAAAGAGAAGAGGGGAGG - Intergenic
1200415573 Y:2906590-2906612 AAGAAGAAGGAGGAGAGGGGAGG - Intronic
1201286028 Y:12379439-12379461 CAGGACCAAGAGAGGAGGGGAGG + Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202118398 Y:21498083-21498105 GAGGAAAAGGAGAAAATGGGAGG - Intergenic
1202120850 Y:21521623-21521645 GAGGAAAAGGAGAAAATGGGAGG - Intronic
1202123301 Y:21545164-21545186 GAGGAAAAGGAGAAAATGGGAGG - Intronic
1202155705 Y:21884217-21884239 GAGGAAAAGGAGAAAATGGGAGG + Intronic
1202158153 Y:21907758-21907780 GAGGAAAAGGAGAAAATGGGAGG + Intronic
1202184606 Y:22172683-22172705 GAGGAAAAGGAGAAAACGGGAGG + Intronic
1202206754 Y:22413718-22413740 GAGGAAAAGGAGAAAACGGGAGG - Intronic