ID: 996339051

View in Genome Browser
Species Human (GRCh38)
Location 5:122415972-122415994
Sequence GTGGGGTGCAGAAAGTTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996339051_996339053 -6 Left 996339051 5:122415972-122415994 CCACGTAACTTTCTGCACCCCAC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 996339053 5:122415989-122416011 CCCCACCAATTGCTGTTCTATGG No data
996339051_996339057 19 Left 996339051 5:122415972-122415994 CCACGTAACTTTCTGCACCCCAC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 996339057 5:122416014-122416036 ACTGTACTTTTGAAGCCCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996339051 Original CRISPR GTGGGGTGCAGAAAGTTACG TGG (reversed) Intronic
901074692 1:6546470-6546492 GTGGGAAGCAGATAGATACGAGG - Intronic
903460704 1:23518775-23518797 GTGGGATGCAGAAAGAAACCAGG + Intronic
904985724 1:34546900-34546922 GTGGGGTGAGGAAAGTTTTGTGG + Intergenic
906500866 1:46341212-46341234 GTGGGGGACAGAAAGGTAGGTGG - Intronic
907847054 1:58218415-58218437 TTGGGGAGCAGAAAGTTTCTGGG + Intronic
908305890 1:62815655-62815677 GTGCGGTGCAGATACTTGCGAGG - Intronic
909825429 1:80120749-80120771 GTATGGTGCAGAAAGGTAAGGGG + Intergenic
913076117 1:115341807-115341829 CTTGGTTGCAGAAAGTTTCGGGG - Intergenic
913938998 1:125085837-125085859 GCGGGGTGCAAAAAGTGGCGAGG + Intergenic
919830658 1:201538559-201538581 GTGGGGTGGAGAAAGAAAGGAGG + Intergenic
920205408 1:204287557-204287579 GGTGGGTGCAGAGAGTTGCGGGG - Intronic
921937005 1:220804720-220804742 GTGGGGTGCACAAAGTGAATGGG - Intronic
923200082 1:231703161-231703183 GTTGGGTTTAGAAAGTCACGGGG + Intronic
924425037 1:243943016-243943038 GTGGGATGCAGAAATTCAAGGGG - Intergenic
1064031856 10:11887663-11887685 GTGGGGTGAGGAAAGCTACTGGG + Intergenic
1069643858 10:69977111-69977133 GTGGGGTGCAGGAAGGAAGGTGG + Intergenic
1072634454 10:97169064-97169086 GTGGGGTGTAGGAAGTGAGGAGG - Intronic
1081685735 11:45041817-45041839 GTGGGGTGCAGGCAGTTAGAGGG + Intergenic
1084956949 11:72696687-72696709 GTGGGGGGAAGATAGTTACAGGG - Intronic
1089079021 11:115760807-115760829 GTGGGGTGCAGAGAGTGGGGTGG - Intergenic
1089678288 11:120105267-120105289 GTGGAGTGAAGATAGTGACGTGG - Intergenic
1091727651 12:2856911-2856933 GTGGGGTACAAAAAGGTAGGCGG + Intronic
1092077046 12:5682575-5682597 CTGGGGGGCAGAAAGTTCCCAGG - Intronic
1093517806 12:20011251-20011273 GTGTGGTGGAGAAATTTTCGAGG + Intergenic
1096785113 12:54012880-54012902 TTGGGGTTCAGAAACTCACGTGG + Intronic
1098734443 12:74081475-74081497 GTGGGGTGGTGAAAGTTAACTGG - Intergenic
1102965877 12:117124991-117125013 GTGGGCTCCAGACAGATACGAGG + Intergenic
1103452395 12:121038621-121038643 GTGGGGTGTAGACAGCTAGGTGG + Intronic
1105928643 13:25032229-25032251 GTGGGTTGGAGAAAGTAAAGGGG - Intergenic
1106792221 13:33167335-33167357 GTGGGAAGCAGAAAGTAAAGTGG + Intronic
1111910982 13:94311744-94311766 TTTGGGTGAAGAAAGTTAGGAGG + Intronic
1112424811 13:99288303-99288325 ATGTGGGGCAGAAAGTAACGTGG + Intronic
1113966392 13:114155780-114155802 GTGGGGTGCAGAGGGTTGGGAGG + Intergenic
1114476251 14:22997144-22997166 GTGGGAGGCAGAAAGGTACCAGG - Intronic
1116534955 14:46017019-46017041 TTGGGGTGCAGAGATTTAAGAGG + Intergenic
1120313428 14:82860755-82860777 GTGGGGTGCAGGATATTATGTGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1130332699 15:82934252-82934274 GTGGGTGGCAGAAAGTAACGTGG - Intronic
1132900795 16:2253056-2253078 GTGAGGAACAGAAAGTTACTAGG + Intergenic
1133449499 16:5891735-5891757 GTGGGGCCCAGAAAGTTCCTGGG + Intergenic
1135111240 16:19692238-19692260 GGGTGGTGCAGAGAGTTACCGGG - Intronic
1139649499 16:68355277-68355299 GAGGGATGCAGAAAGCTACCTGG - Intronic
1139749040 16:69097574-69097596 GTGTGGTGCAGACACTTGCGTGG + Intergenic
1140862603 16:79031259-79031281 GTGGGGTGCTGAGAGGTACGTGG + Intronic
1143634972 17:8159357-8159379 GTGGGGGGAAGAAAGTTTGGGGG + Exonic
1153968860 18:10206476-10206498 GTGATGTGCAGATAGATACGAGG + Intergenic
1157701418 18:49763313-49763335 GAGGGATGCAGAAAATTATGAGG - Intergenic
1160406205 18:78648059-78648081 CTGTGCTGCAGCAAGTTACGTGG - Intergenic
1160458750 18:79021460-79021482 GTGGCCTTCAGAAAGTTACCTGG + Intergenic
1167105648 19:47428817-47428839 GTGGGAAGCAGAAAGTTATGGGG + Exonic
1202680949 1_KI270712v1_random:5452-5474 GCGGGGTGCAAAAAGCTGCGGGG + Intergenic
1202681250 1_KI270712v1_random:6525-6547 GTGGGGTGCAAAAAGCGGCGGGG + Intergenic
934928724 2:98402248-98402270 GTGGAGTGCAGAGAGTTTCAGGG + Intergenic
936777288 2:115989193-115989215 GTGGGGTGCAGATGGTTAATGGG - Intergenic
938650906 2:133382499-133382521 GTGGTGTGCAGAGAGTTAAGGGG - Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
944515498 2:200508926-200508948 TTGGGGGGCAGAAGGATACGTGG - Intronic
947582504 2:231330430-231330452 GTGGGGCGCAGTGAGTGACGGGG - Intronic
1181953415 22:26571146-26571168 GTTGGGGGCAGAAAGGTAAGGGG - Intronic
1183356107 22:37360537-37360559 GTGGGGTGTACAGAGGTACGTGG - Intergenic
1184030764 22:41893034-41893056 GTGGGGTGCAGAAAGCACCATGG - Intronic
1184354468 22:43969700-43969722 GTGGGGTGAAGAATGTTCTGGGG + Intronic
952155944 3:30643729-30643751 GTGAGGTGGAGAAAGTTTCATGG + Intronic
961716477 3:128861106-128861128 GTGGGGTGCAGGAGGTGAAGGGG + Intergenic
966606317 3:181824958-181824980 TTGGGGGGCAGAAAGTCACACGG + Intergenic
967705508 3:192645261-192645283 GTGGGGTGAGGCAAGTTAGGAGG + Intronic
968969279 4:3785075-3785097 GTGGATTCCAGAAAGTTCCGTGG + Intergenic
971159939 4:24123340-24123362 GTGAGGTGCAGGAAATTACTGGG - Intergenic
975320156 4:73000955-73000977 GTGGGGAGGAGGAAGTTACAGGG + Intergenic
975703909 4:77092898-77092920 GTGGGCTGGAGAATGTTATGAGG + Intergenic
976611705 4:87037272-87037294 TTAGGGTGCAGAATGTTAAGTGG - Intronic
984849679 4:184143061-184143083 GTGTGGTGCAGAAAGTCAAGAGG - Intronic
984955063 4:185036970-185036992 GTGGGAAGCAGAAAGCCACGAGG - Intergenic
985950389 5:3218186-3218208 GTGTGGAGCAGACAGTGACGGGG - Intergenic
993308740 5:86301670-86301692 GTGGGTAGCAGAAAGTTGTGAGG + Intergenic
996339051 5:122415972-122415994 GTGGGGTGCAGAAAGTTACGTGG - Intronic
996855459 5:128000880-128000902 GTGTGGTTCAGAAAGTAAGGGGG + Intergenic
1005412823 6:25568319-25568341 GTGGGGTGAACAGAGTTAAGAGG + Intronic
1005714339 6:28532618-28532640 GTGTGGTGAAGAAAGTTGTGTGG + Intronic
1007462907 6:42030927-42030949 GTGGGGTGCAGGAAGGCACTTGG + Intronic
1011632851 6:89344425-89344447 GAGGGGTGAAGAAAGTTGTGGGG - Intronic
1011706932 6:90010251-90010273 GTGGGGTACAGAGAGGTACAAGG - Intronic
1013403238 6:109819048-109819070 ATGGGATGCAGAAATTTACAGGG - Intronic
1014118082 6:117688881-117688903 TTGGGGTGCAAAAATTTAAGGGG - Intronic
1015288255 6:131509097-131509119 TTGGGGTGCAGAGATTTAAGAGG + Intergenic
1015930319 6:138353035-138353057 GTGAGGTGCAGTAAGTTGCAAGG - Intergenic
1016378634 6:143450397-143450419 ATGGGCTACAGAAAGTTTCGAGG + Intronic
1019194172 6:170271657-170271679 GTGGGGTGAAGCCAGTGACGTGG - Intergenic
1021904685 7:25321792-25321814 ATGGGGTGCAGGAAGTTGGGAGG - Intergenic
1026891464 7:73985275-73985297 GTGGGGGGCAGAAAGTCAGCCGG + Intergenic
1027644017 7:80773761-80773783 GTGGGTTTCAGAAATTCACGTGG + Intronic
1028701614 7:93787354-93787376 GTGGGGGGCAGTAAGATACGTGG - Intronic
1033058911 7:138086259-138086281 GTGGTGTCCAGAAATTTACAGGG - Intronic
1044935817 8:97292553-97292575 CTGGGGTGCAGAAGGTTGCATGG + Intergenic
1051140799 9:13977243-13977265 GTGGGGTGGGGAAGGTTACTGGG + Intergenic
1052410969 9:28120575-28120597 GTGGGGTGAAGAAAGGGAGGCGG - Intronic
1187071840 X:15896379-15896401 GTGGGGTGGGGAAAGTGAGGAGG - Intergenic
1197804135 X:130383261-130383283 GTGGGGTACAGAAAATGACAAGG - Intergenic
1201769688 Y:17607794-17607816 CTGGGGAGCAGAAAGTTGCATGG + Intergenic
1201831866 Y:18298191-18298213 CTGGGGAGCAGAAAGTTGCATGG - Intergenic