ID: 996339887

View in Genome Browser
Species Human (GRCh38)
Location 5:122424971-122424993
Sequence CATTCAACAAACATAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996339884_996339887 30 Left 996339884 5:122424918-122424940 CCAGTTCTCTACAATTCAAGGCA 0: 1
1: 0
2: 0
3: 10
4: 122
Right 996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG 0: 1
1: 0
2: 1
3: 28
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996339887 Original CRISPR CATTCAACAAACATAGAACA GGG Intronic
901737724 1:11322945-11322967 CATTCAACAAACAGAGCACCTGG - Intergenic
904125960 1:28238772-28238794 CAATCTACAAAATTAGAACAAGG - Intronic
906236757 1:44216137-44216159 CATTCAACAAATATTTACCATGG - Intronic
907197797 1:52700693-52700715 AATTTAATAAACATGGAACATGG - Intergenic
908682697 1:66679973-66679995 CATTCAACAAAATTATACCAAGG - Intronic
910599179 1:89012278-89012300 CATTCAACTAACACAGGACTAGG - Intronic
911293174 1:96082217-96082239 CATTCTTCAAGCATAGAAAAGGG - Intergenic
912909063 1:113738397-113738419 CATTTAACAAACATCTAAGAGGG - Intronic
913691860 1:121287222-121287244 CAATAAACAAAAATAGAAAATGG - Intronic
913990697 1:143609175-143609197 TATTTATCAAACAGAGAACAAGG - Intergenic
914145687 1:144992732-144992754 CAATAAACAAAAATAGAAAATGG + Intronic
914248517 1:145903236-145903258 CATTCAACAAATATTGCACTTGG + Intronic
914940704 1:152020478-152020500 TATTTATCAAACAGAGAACAAGG + Intergenic
916528915 1:165637444-165637466 CATTCCACAAACAAAGCAAAAGG - Intronic
917489066 1:175482152-175482174 CATTCAACAAACATTTATCAAGG - Intronic
918173377 1:182020851-182020873 CAATCATCAAAGATAAAACATGG - Intergenic
918335098 1:183502108-183502130 CATTAAACAAAAAAAGAAAAAGG + Intronic
918545622 1:185680552-185680574 TATTCAATAAACATAGAGTAAGG - Intergenic
919016935 1:192050479-192050501 AATTCAACACACATACAGCATGG - Intergenic
919278990 1:195462152-195462174 CATTCAACAAAGATTTAACTTGG + Intergenic
919439877 1:197619245-197619267 CATTTAACAATTATAGACCATGG + Intronic
920479193 1:206305730-206305752 CAATAAACAAAAATAGAAAATGG - Intronic
921622044 1:217336091-217336113 CATTCAACTAACACATACCAGGG - Intergenic
921693519 1:218180784-218180806 AATTCAACAAAGACAGAACAGGG + Intergenic
923280259 1:232436723-232436745 CACTCAACACACAGAAAACAAGG + Intronic
923523482 1:234754634-234754656 CAATCAACAAACATTCAACATGG - Intergenic
924072172 1:240292093-240292115 TGTGGAACAAACATAGAACATGG - Intronic
924501981 1:244646271-244646293 GATTAAACAAAGATACAACAGGG - Intergenic
1063940172 10:11120418-11120440 TATTCAACAATCATAGAAACAGG - Intronic
1065755768 10:28929077-28929099 CTTTGAAGAAACCTAGAACATGG + Intergenic
1067179449 10:43973780-43973802 CATTCAACCAACACAGAACAGGG - Intergenic
1068335018 10:55623538-55623560 CATTCTATGAACATAGGACAGGG + Intronic
1068457778 10:57281017-57281039 TATACAACATACAAAGAACATGG + Intergenic
1068864357 10:61879472-61879494 CATTCAACACTCAGAGTACATGG + Intergenic
1069837934 10:71320778-71320800 CATTCAGCAAACATTGACAAGGG + Intronic
1070109923 10:73475609-73475631 AATGAAACAAACATAAAACATGG - Intronic
1070551871 10:77496294-77496316 CATTCAAGAAAGAGAGGACAGGG + Intronic
1071102939 10:82060705-82060727 AATTCCACTAACAAAGAACAAGG - Intronic
1071200005 10:83211122-83211144 CATTAAACAAATATATATCAAGG + Intergenic
1071320178 10:84447356-84447378 CATTCCATAAACATACAAAAAGG - Intronic
1072547880 10:96454475-96454497 CATCCAACAACCAGAGAACAGGG - Intronic
1073882092 10:107994537-107994559 TACTCAACAAACAAAGAGCAAGG - Intergenic
1073966106 10:108992266-108992288 CACTTAATAAACATAGACCAAGG - Intergenic
1074183764 10:111084112-111084134 AATACAAAAAAAATAGAACAGGG + Intergenic
1074339134 10:112609286-112609308 TATTGAACAAACATTTAACATGG + Intronic
1075225716 10:120627327-120627349 CATTCACCTTACACAGAACATGG + Intergenic
1075233556 10:120706029-120706051 CATTGAAAAAACATACAAAAAGG - Intergenic
1077372188 11:2188168-2188190 CATTCCACGAACACACAACAGGG - Intergenic
1079120782 11:17683378-17683400 AATTTACCAATCATAGAACAAGG + Intergenic
1080019075 11:27540215-27540237 CATTCAACAAACATTTTACTGGG + Intergenic
1080584793 11:33672081-33672103 CATTTCACAAACACAGAACACGG + Exonic
1081071348 11:38613777-38613799 CATTGAAAAAACAAAGTACATGG - Intergenic
1081624621 11:44642928-44642950 CATTCAACTAAAATTGACCAGGG + Intergenic
1082203891 11:49407252-49407274 CATTCACCAAACAAAAATCACGG + Intergenic
1083384673 11:62298816-62298838 TATTCAACAAGCACAGAAAAGGG + Intronic
1085213404 11:74803717-74803739 TATTCAACAGACATAAAACTGGG + Intronic
1085572434 11:77571330-77571352 CATTAAACAAAGACAGAGCAGGG - Intronic
1085573005 11:77575874-77575896 CATTAAACAAAGACAGAGCAGGG - Intronic
1085913310 11:80854278-80854300 CATTCAACAAATATCCCACATGG - Intergenic
1086046935 11:82543881-82543903 AGTTCAACAAAGAAAGAACAGGG + Intergenic
1086651202 11:89293269-89293291 CATTCACCAAACAAAAATCATGG - Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088939712 11:114440458-114440480 TATTCAACAAACATTTACCAAGG - Intronic
1090959952 11:131547312-131547334 CATTTAACAAAAAGAGAAAAGGG + Intronic
1091060613 11:132457971-132457993 CAGTCAACAAACCAATAACATGG + Intronic
1091274256 11:134339623-134339645 CATTCTAAAAATATAGAAAATGG + Intronic
1092606748 12:10128543-10128565 CATGCAACAAACATATGAAAAGG - Intronic
1093005020 12:14042048-14042070 CATTCCACAAACAGTGCACAAGG - Intergenic
1094333435 12:29321608-29321630 CATTCAACAGAAAAAGAAAAGGG - Intronic
1095492237 12:42746764-42746786 AAATCAACAATAATAGAACAGGG - Intergenic
1095683761 12:45008717-45008739 TATTCAGAAAACAGAGAACATGG + Intergenic
1097474537 12:60037049-60037071 CATTCAACAAATATAGTCCAGGG - Intergenic
1099660447 12:85551796-85551818 CATTCAGCAAACATTTATCAAGG + Intergenic
1099693172 12:85987022-85987044 CTATCATCAAACTTAGAACAAGG + Intronic
1100475284 12:94929883-94929905 CATTTAACACATATATAACATGG + Intronic
1101306558 12:103534079-103534101 CAATCAACAAAAATAGATTAAGG + Intergenic
1102019782 12:109674259-109674281 TATTTAACAAACAAAGAAAATGG - Intergenic
1102857042 12:116303108-116303130 CAATCAATAAACATTTAACAGGG + Intergenic
1103523405 12:121551177-121551199 TATTCAACAAATATTGACCACGG - Intronic
1103885167 12:124195071-124195093 CATTCAGCAAATATTGACCAAGG - Intronic
1104522642 12:129489364-129489386 CACTCAATAAACATTGATCAAGG - Intronic
1104565334 12:129876050-129876072 CATTCGACAGACCTAAAACATGG + Intronic
1106316008 13:28594324-28594346 AATTAAACAAAAATAAAACAAGG + Intergenic
1107093370 13:36508530-36508552 CATTTAAGAAACATAAAATAAGG - Intergenic
1107385443 13:39903443-39903465 AATTCAACAAACATTTACCAAGG - Intergenic
1108794727 13:54017698-54017720 CATTCACCACACACAAAACAAGG + Intergenic
1109033358 13:57222845-57222867 CAGCCAACAAACATATAAAAAGG + Intergenic
1109937940 13:69317833-69317855 CATTTTACAAACAAAGAAAATGG - Intergenic
1110736673 13:78944947-78944969 CATACAAAAAATATAGGACATGG + Intergenic
1111050397 13:82876233-82876255 TAATCACAAAACATAGAACATGG - Intergenic
1111584335 13:90264391-90264413 CATTCAGCATACATTGAATAGGG - Intergenic
1112266021 13:97924432-97924454 CATTCAATAAAGACAGTACAGGG + Intergenic
1112773203 13:102814414-102814436 GATTCAACAAAAAGAGAATAGGG + Intronic
1112787068 13:102962761-102962783 CATTCAACTATCTTAGAAGAGGG + Intergenic
1113917844 13:113884710-113884732 CATTCAATAAACACTGAATATGG - Intergenic
1114288961 14:21272040-21272062 CATACAACAAACAAAAGACAGGG - Intergenic
1115052346 14:29078686-29078708 CATTCAACAACCCTCTAACATGG + Intergenic
1115418273 14:33162076-33162098 CATTCAGCAAATATACATCAGGG - Intronic
1117562685 14:56958274-56958296 CATTCCACATAAATAGATCACGG - Intergenic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1120171360 14:81249589-81249611 AAGGCATCAAACATAGAACATGG + Intergenic
1124899423 15:33808581-33808603 CATCCATAAAACATAGAACCTGG - Intronic
1128584452 15:68835665-68835687 CATGCAACAAAAAAAGAAAAAGG + Intronic
1129042886 15:72705558-72705580 CACTCAAGAAACACAAAACATGG + Intronic
1130096854 15:80862482-80862504 CATTCAACACACATAGGACCTGG - Intronic
1131627600 15:94138903-94138925 TATGCAACAAATATAAAACAAGG - Intergenic
1132200101 15:99945994-99946016 CTTTCAACACACACAGAAAAAGG - Intergenic
1133568184 16:7015030-7015052 CATTCAGGAAGCATAGAACCTGG - Intronic
1135611103 16:23867973-23867995 CATCCATCACACATAAAACAGGG + Intronic
1138135517 16:54517858-54517880 CATTCAACAAATACAGAGCCTGG - Intergenic
1138970753 16:62140390-62140412 CATTGAATAAACAAAGAATAAGG + Intergenic
1139111338 16:63894722-63894744 CAATCAGCAAACATGGATCATGG + Intergenic
1140381043 16:74488159-74488181 CAATCACCAAGCAGAGAACAGGG + Intronic
1140685505 16:77430365-77430387 GTTTCAACTAACAAAGAACATGG + Intronic
1140721347 16:77775177-77775199 CATTCAACAACCACGAAACAAGG - Intergenic
1141059088 16:80848152-80848174 GATTAAACAAAAAAAGAACAGGG + Intergenic
1141789659 16:86225961-86225983 CATTCAACAAACATTCCACAGGG - Intergenic
1144183964 17:12778564-12778586 CATTCAACCTTCATAAAACAGGG - Intergenic
1145191850 17:20848649-20848671 CATTCTATGAACATAGGACAGGG + Intronic
1145402060 17:22548682-22548704 CATTCTATGAACATAGGACAAGG + Intergenic
1146494465 17:33308954-33308976 TGTTCAACATACGTAGAACATGG - Intronic
1148205889 17:45779701-45779723 CATTCAACAAACATTTAATGAGG - Intergenic
1149062738 17:52442495-52442517 CATTCTACAAACTGGGAACAAGG - Intergenic
1149128577 17:53266733-53266755 CATTTAACAAAGAAACAACATGG - Intergenic
1150674950 17:67237037-67237059 CACTCAAGAAACAAAGAACCTGG + Intronic
1151175332 17:72283670-72283692 CATTCAAGAATCTTAGAGCAGGG + Intergenic
1152698008 17:81805907-81805929 CAGTCAACAAACATTGATCCTGG + Intronic
1153469080 18:5422879-5422901 CATTCAAATAACAGAGCACAGGG - Intronic
1153490100 18:5638519-5638541 CATGCATCAAGCAAAGAACAAGG - Intergenic
1156001417 18:32388859-32388881 CAATCAACAAAACTGGAACATGG + Intronic
1156131838 18:33985754-33985776 CATACAACAAAGATAGATTATGG - Intronic
1156656998 18:39300121-39300143 AATGTAATAAACATAGAACATGG + Intergenic
1157401165 18:47389734-47389756 CAATTTACAAACATAAAACAAGG - Intergenic
1158234397 18:55296922-55296944 CATTGAACAAACACAAAGCATGG - Intronic
1158675884 18:59517855-59517877 CATTCAACAAACATGGTCAAGGG + Intronic
1158751601 18:60267871-60267893 CATTCAGAAAACTTAAAACAGGG - Intergenic
1159318734 18:66817457-66817479 CAAACAACAAACAGACAACAAGG + Intergenic
1161399501 19:4061094-4061116 CATTCAGCAAACTTAGCCCAGGG + Intronic
1164714680 19:30382869-30382891 CATTTAGCAAACATAAACCAGGG + Intronic
1165055253 19:33172262-33172284 CATTCAACAATCAAAAGACATGG - Intronic
1165127420 19:33609524-33609546 GATCCAACATACAGAGAACAGGG - Intergenic
1166738870 19:45102314-45102336 CATTTCACAAACATGGAACGAGG - Intronic
1167571939 19:50293757-50293779 TATTCAACAAATATAGAAAGGGG + Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
1167751481 19:51382927-51382949 CATTCAACAAACATTTCCCAAGG - Intronic
1167851821 19:52208023-52208045 CATTCCACAAACATTGAGCAAGG + Intronic
1168529726 19:57118280-57118302 CATTCCACAAACATGCAGCAAGG - Intergenic
925203746 2:1989693-1989715 CATTCAAAAAACTTAGACTAGGG + Intronic
925469550 2:4144140-4144162 TATTCAAAAAGCATTGAACAAGG - Intergenic
926680080 2:15656262-15656284 CATTCAACAAACACTGACCGTGG - Intergenic
928215987 2:29361817-29361839 CAGTCAATAAACAAAGAACCAGG - Intronic
928673236 2:33623758-33623780 CATTCTAAATACTTAGAACAGGG + Intergenic
929395107 2:41513522-41513544 CATTAAAAAAAAAAAGAACATGG - Intergenic
931017550 2:58002037-58002059 TATTTCACAAACCTAGAACATGG + Intronic
931198101 2:60072349-60072371 CTTTCAACAAACATCCATCAAGG - Intergenic
931212298 2:60208663-60208685 CATTCAACAATTATTGAATATGG - Intergenic
932389643 2:71374920-71374942 TCTTAAACAAACAAAGAACATGG + Intronic
933279277 2:80314803-80314825 CCTTCCTCAAACATGGAACAAGG + Intronic
933549662 2:83760202-83760224 AATGCAAAGAACATAGAACAGGG - Intergenic
937836145 2:126471990-126472012 CATTCAACAAACATTTACCGAGG - Intergenic
938052584 2:128188427-128188449 CATTCAAGACACACACAACAGGG - Intronic
938589909 2:132726535-132726557 CATTCTACAAACAGAAAAAAGGG - Intronic
939354608 2:141084985-141085007 AATGCAAGAAACATAAAACATGG - Intronic
939836300 2:147133648-147133670 CATTAAACAAACATACCAGAAGG + Intergenic
940312950 2:152297759-152297781 CATTCAACAAAGATAAAAACAGG + Intergenic
940885050 2:158982427-158982449 CATTCTACAGACATAGAAACAGG - Intronic
941924473 2:170882206-170882228 CATTGAACAAAAATATAAGAGGG - Intergenic
941964664 2:171289168-171289190 CATTCAACAAATATAGATTATGG + Intergenic
943090566 2:183369657-183369679 CATTCAATAAACAAAGAAGCAGG + Intergenic
944093595 2:195941962-195941984 CATTTAACAAACATTTACCAAGG + Intronic
944098294 2:195994482-195994504 GATTCAACCAACACAGGACATGG - Intronic
944802890 2:203253553-203253575 CATTGAACAAAGACAGAACGTGG + Intronic
945177937 2:207062509-207062531 TATTCAAAAAACACAGAAAAAGG - Intergenic
945241049 2:207677342-207677364 AATTCAGCAAACATTTAACATGG - Intergenic
945583994 2:211634221-211634243 CATTCAAGAAAAAGAGAACAAGG - Intronic
945765178 2:213967703-213967725 CCTTTAATAAACATAAAACATGG - Intronic
947809917 2:232997828-232997850 TATTCAACATACAGAGCACAGGG - Intronic
948414458 2:237792325-237792347 CATTTCACAAACTTTGAACATGG + Intronic
1169020088 20:2324409-2324431 CACTCAACAAACAAAGAACCAGG - Intronic
1169529258 20:6466556-6466578 CCTTCCATAAACAAAGAACAAGG + Intergenic
1169807371 20:9573494-9573516 CATTTAACTAACATGGATCAGGG - Intronic
1171086486 20:22242777-22242799 CTTTCAAAGAACATAGAGCACGG + Intergenic
1173934431 20:46848764-46848786 CATGGAACAAACAGAGAACAAGG + Intergenic
1174057985 20:47811812-47811834 CATTCAACAAACATTTATCAAGG + Intergenic
1174953442 20:55067786-55067808 ACTTCAATAAACATAGTACATGG + Intergenic
1177816017 21:25977755-25977777 CAATGAACAAGAATAGAACATGG + Intronic
1178591152 21:33911548-33911570 GATTCTACAAGCATAGAATATGG + Intronic
1178995618 21:37396550-37396572 GATTCTAAAATCATAGAACAGGG - Intronic
1181972120 22:26698801-26698823 TATTCAACAAAAATGGAACCAGG - Intergenic
1182728560 22:32468927-32468949 CATTCTAGAAACCAAGAACAGGG - Intergenic
949432443 3:3992077-3992099 GATTCAACAAACATTTATCAAGG + Intronic
949708281 3:6843423-6843445 TATTCATCAAACACAGAACTCGG + Intronic
950631100 3:14282518-14282540 CATGCAGCAAGCATAGCACAGGG + Intergenic
951033129 3:17904899-17904921 CCTTCACCAAACCTAAAACAAGG - Intronic
951036052 3:17933373-17933395 CCTTCAACAAACAGAGAATGAGG + Intronic
951806124 3:26646043-26646065 CATTCATCAACAAGAGAACAAGG - Intronic
952431866 3:33231516-33231538 AATTCATCAAACATAGACCGAGG - Intergenic
952490248 3:33863905-33863927 CATACATGAAACATAGAAAATGG - Intronic
952831799 3:37571313-37571335 CATTCATTAAACATAAACCATGG - Intronic
953767615 3:45755972-45755994 CATTTAAAAAAGAAAGAACATGG - Exonic
953798950 3:46006731-46006753 CATACAAAAAACATAGCACTTGG + Intergenic
955942942 3:64164037-64164059 CATTCAACAAATGGAGAAGATGG + Intronic
956619972 3:71212056-71212078 TATTTAACAAAGAAAGAACATGG - Intronic
957144837 3:76411227-76411249 AATTCAACAAACATATATCAAGG + Intronic
957397700 3:79664098-79664120 CCTATAACAAACTTAGAACATGG - Intronic
957893976 3:86395561-86395583 GATGCAACAAAGATAGATCAAGG - Intergenic
958145027 3:89613049-89613071 CATTCAGCAAACATGAAACTAGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
959643095 3:108663823-108663845 CATTCACCAAACATTTATCAAGG + Intronic
960411549 3:117333017-117333039 CTTTCAACAAACAAATTACAAGG - Intergenic
960650167 3:119939154-119939176 AACTCAACAAAAATAGAGCAGGG + Intronic
962787699 3:138783686-138783708 AATTCAACAAGCAGAGTACAGGG + Intronic
963362313 3:144289990-144290012 CATTCAAATAAAATAGAAGAGGG + Intergenic
963479725 3:145856019-145856041 ATTAAAACAAACATAGAACAAGG + Intergenic
963812624 3:149793834-149793856 CAATCAATAAACATAAAAAAGGG + Intronic
964269293 3:154938314-154938336 AATTCAACAAACATAAATAAAGG + Intergenic
964455623 3:156862596-156862618 TAGTTAACAAACATAGAAAAAGG - Intronic
964592317 3:158378388-158378410 CATTCAACATCTAAAGAACAAGG - Intronic
966283356 3:178262383-178262405 CTTTCAACAAACATGTAACCAGG - Intergenic
966326098 3:178756432-178756454 CATAAAACACACATAAAACAAGG - Intronic
966998159 3:185305063-185305085 CAATCAAAAGACATAGAAAATGG - Intronic
967366263 3:188689711-188689733 GATTCAACAAATATAGTAAAGGG - Intronic
968743942 4:2348991-2349013 CATGCAATAAACAGAAAACAAGG - Intronic
969918870 4:10517896-10517918 CATTCAACAAAGATACAACCAGG - Intronic
970420924 4:15905217-15905239 CATTCAACAAACGTGGAGCCAGG - Intergenic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
970879966 4:20917326-20917348 CATTCAAAAAATATAAATCATGG - Intronic
971573208 4:28240262-28240284 TATACAAAAAACATATAACAAGG + Intergenic
971637237 4:29076779-29076801 CATTCAATATACATAGGACATGG + Intergenic
972140567 4:35954086-35954108 CATCCAACAAGCATAGGAAAAGG - Intronic
972864990 4:43220863-43220885 TATTCAGAACACATAGAACAAGG - Intergenic
973014528 4:45121289-45121311 CAATAAACAAACATAAAAGAGGG + Intergenic
973022934 4:45225949-45225971 CATCCAACAAACATACATGATGG - Intergenic
974369426 4:60995769-60995791 CTTTAAAAAAAAATAGAACAAGG - Intergenic
975911688 4:79274506-79274528 CATTCAACAAGCCTAATACAGGG + Intronic
977289431 4:95147841-95147863 CATTCAGCACCCTTAGAACAGGG + Intronic
977419563 4:96781084-96781106 CATCCCACCAACATAGTACAGGG - Intergenic
977757958 4:100696094-100696116 CATTCAACAAACATTTATGAAGG + Intronic
978198443 4:105997385-105997407 CATTCAACCAACATTTATCAAGG - Intronic
978482380 4:109208337-109208359 CATTCAACAAACATACACTGAGG + Intronic
978814605 4:112889557-112889579 CAGTCAAAAAAAAAAGAACAAGG - Intronic
978872915 4:113602263-113602285 CACTCAACAAACACATAATACGG + Intronic
980259570 4:130431091-130431113 TATTCAACATATATATAACATGG + Intergenic
981186070 4:141805026-141805048 CATTCAAACATCATAGTACAAGG + Intergenic
982011190 4:151107773-151107795 TATTCAACAAATATTGAACTAGG - Intronic
982571514 4:157056574-157056596 CATTCAACAAAAAAATTACAAGG - Intergenic
983193107 4:164775348-164775370 CATTCATGAGACAAAGAACAAGG - Intergenic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
983643933 4:169970505-169970527 CATTCAACAAATATTGACTAAGG - Intergenic
984314516 4:178109989-178110011 CAAACCACAAAGATAGAACAAGG + Intergenic
984975856 4:185229433-185229455 AAGACAACAGACATAGAACATGG - Intronic
985981656 5:3473792-3473814 CCTTCAAAAAACAGAGAAAAGGG + Intergenic
986114559 5:4759411-4759433 AAATCAACAAACATACAACTTGG - Intergenic
986926170 5:12755116-12755138 CCTTCAAATAAAATAGAACAAGG + Intergenic
987317485 5:16737524-16737546 TATTCAACTAAAATAGAAAATGG - Intronic
988100707 5:26673647-26673669 CAATCAACAAACATATACGATGG + Intergenic
988114379 5:26866046-26866068 GATTAAAGAAACATAGAAAATGG - Intergenic
988185370 5:27854206-27854228 AATTCAACAAACTTAAAACATGG + Intergenic
989643722 5:43606843-43606865 AATTCAACAAATATATACCAAGG - Intronic
989840269 5:46056838-46056860 CATTCAACAAACAGAGGTAAAGG + Intergenic
990452567 5:55949795-55949817 CATTCAACCAACAAGGCACATGG + Intronic
990633871 5:57700714-57700736 CATTCAAGCAACATAGAAGGGGG + Intergenic
990646667 5:57853073-57853095 ACTTCAACAAAAATACAACATGG - Intergenic
990866643 5:60387609-60387631 CATAAAACAACCCTAGAACAAGG - Intronic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
991244689 5:64497861-64497883 CAATTAGGAAACATAGAACAGGG - Intergenic
991557842 5:67915442-67915464 CATTTAAGAAAAAAAGAACAAGG + Intergenic
992554566 5:77890766-77890788 CACTACACAAATATAGAACAAGG + Intergenic
992614706 5:78536886-78536908 AATTCAACAAAAATTGAGCAGGG + Intronic
993100679 5:83535963-83535985 CATTCAACTGTCCTAGAACAGGG - Intronic
993600012 5:89910789-89910811 CTTTTAACACACATAGAACTAGG - Intergenic
994706742 5:103216176-103216198 CATTTAAAAAACATTTAACAGGG + Intergenic
996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG + Intronic
996482736 5:123993323-123993345 CATTAAACAAACAAAAAACATGG + Intergenic
999339145 5:150753683-150753705 CATTCAACAAATATTTATCAAGG + Intronic
999874714 5:155790952-155790974 CAATAAACAAAAATAGAATAAGG + Intergenic
1000489580 5:161894277-161894299 CATTCAGCAGTTATAGAACAGGG + Intronic
1000593739 5:163189825-163189847 AATTCAAGAAACATTGAAGATGG + Intergenic
1000655936 5:163877783-163877805 CATTCAACAAAAATAGATCGAGG - Intergenic
1000794252 5:165645555-165645577 AATACAATAAACATAGAGCAGGG - Intergenic
1002420013 5:179140724-179140746 CAACCAAAAAACAGAGAACAAGG + Intronic
1004347563 6:14862801-14862823 CATTCAATAAACAGAGATTAAGG + Intergenic
1004611284 6:17242432-17242454 CAGAGAACAAACAGAGAACATGG - Intergenic
1011475051 6:87743541-87743563 CATTCTAGAAACAGAGATCAAGG - Intergenic
1014827673 6:126064869-126064891 AACTAAACAAACATAAAACAAGG - Intergenic
1015791305 6:136967191-136967213 AATTCATCAATCATAGAAAAGGG - Intergenic
1016079876 6:139843119-139843141 CATTCCACAAATATGTAACAAGG - Intergenic
1017117567 6:150993102-150993124 CATAAAACAAACAAAGAAAAAGG - Intronic
1017256475 6:152339240-152339262 CATTCAACAAACAGAGCAAACGG - Exonic
1017825144 6:158076242-158076264 TAGTCAACAAACATAGATGAAGG + Intronic
1018117093 6:160597769-160597791 CAGTCAATAAAAATAGAACCAGG - Intronic
1018325248 6:162660954-162660976 CATTCAACTAAGAAAGAACAAGG + Intronic
1018736871 6:166693508-166693530 CAGTCCACAAATATGGAACAGGG - Intronic
1023179937 7:37471585-37471607 AATTCAACAAACATATACCTAGG + Intergenic
1023756813 7:43426259-43426281 CATACAAAATACATAGAATACGG + Intronic
1024386181 7:48754510-48754532 CATTCAACAAACAAATCATAAGG + Intergenic
1024442898 7:49442364-49442386 CATTCCACAACCACACAACAAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027451958 7:78342184-78342206 CAGTCAACAAACATAAAAAAAGG + Intronic
1028491680 7:91419327-91419349 CTTTTTACAAACATAGGACAAGG - Intergenic
1028760904 7:94495396-94495418 CATTAAAAAAAAATAGAGCAAGG + Intergenic
1031227737 7:119062131-119062153 CATCCAAGAAACACTGAACAAGG + Intergenic
1032045341 7:128602027-128602049 CAATCAACAAACTCAGAATAGGG - Intergenic
1032334794 7:131015663-131015685 CATTAAACAAACAGATAAAAAGG + Intergenic
1034539376 7:151746553-151746575 CATTTCACAAACAGAGGACATGG + Intronic
1037141005 8:15520775-15520797 TATTCAACAAACATACAGTAAGG + Intronic
1038900343 8:31835307-31835329 CATTCTGTAAAAATAGAACATGG + Intronic
1039159416 8:34600159-34600181 CATTTAACATAAAAAGAACATGG + Intergenic
1039188728 8:34947625-34947647 CATTCCAGAAACATAGAAACTGG + Intergenic
1039249010 8:35641095-35641117 CATTCACAAAACATAGATTAGGG + Intronic
1039599583 8:38823598-38823620 CATTCAACAAAAACAGAATAGGG - Intronic
1041517853 8:58721839-58721861 CACTAAACTAACATAGAATACGG + Intergenic
1041681180 8:60593691-60593713 CATTCATCATACCTAGAACCAGG + Intronic
1041870500 8:62628934-62628956 CATTCAACAAATATGTATCAAGG - Intronic
1041925550 8:63232193-63232215 CAGTCAACAAAAATAGACCCAGG - Intergenic
1041988712 8:63958404-63958426 CAAGCAACAAAGATAAAACATGG + Intergenic
1043055103 8:75427652-75427674 CATTCAACAAATACTTAACAAGG - Intronic
1043467322 8:80524439-80524461 CAGTCCACAAATATACAACATGG - Exonic
1043636146 8:82385274-82385296 CATCCACCACACATAGAACATGG - Intergenic
1044149494 8:88757404-88757426 CATTTAAGAAATATAGAATATGG + Intergenic
1045655238 8:104380126-104380148 CATTCAATAATGAAAGAACATGG + Intronic
1045718335 8:105075096-105075118 CAATCAATAAACATTGAAGAAGG - Intronic
1045857119 8:106777401-106777423 CATTCCACGAACATTGAGCATGG - Intergenic
1046360198 8:113143432-113143454 CATGCAACTAACATACAACCTGG + Intronic
1046747247 8:117889379-117889401 CATTCAACAAATTTAGCTCAGGG + Intronic
1046858244 8:119060360-119060382 CATTCAAAACACATAGTATATGG - Intronic
1048290694 8:133179231-133179253 CATAAAAGGAACATAGAACAGGG + Intergenic
1048832942 8:138494297-138494319 CATTCAACAACCATTCATCATGG + Intronic
1051210249 9:14734474-14734496 CATTTGACAAATATTGAACATGG - Intergenic
1051988051 9:23114558-23114580 CTTTCAACAATCATATATCAGGG + Intergenic
1052524726 9:29600831-29600853 CATTCAACATACACAACACACGG + Intergenic
1055249618 9:74287278-74287300 CATTCAACAAATATGAAATATGG - Intergenic
1055915118 9:81392813-81392835 CATTCCACAAACACTGAATAAGG + Intergenic
1059081762 9:111257420-111257442 CAAAGAACAAGCATAGAACAAGG + Intergenic
1059318380 9:113446695-113446717 CATTCATCAAGCATTGATCAAGG - Intronic
1059730730 9:117054401-117054423 CATTCAACAAATATATATTAAGG + Intronic
1060064607 9:120493752-120493774 TATTCAACAAACAAATTACATGG + Intronic
1060123343 9:121017756-121017778 CATTCCAGTAACACAGAACATGG - Exonic
1061452299 9:130674730-130674752 CATTGTATAAACATATAACATGG - Intronic
1062202944 9:135316779-135316801 CATTAAATAAAGATAGAAAAGGG + Intergenic
1186083884 X:5964990-5965012 CATCTAATATACATAGAACACGG + Intronic
1186347049 X:8704299-8704321 CATTCAACATACACAGTAGAAGG - Intronic
1187415210 X:19087250-19087272 CATTCAACAAACATTTAACTGGG + Intronic
1188507184 X:30895231-30895253 CCTTCAATAAACATAAAAAATGG + Intronic
1188507370 X:30897022-30897044 CATTCAACAAATATATAAGGAGG + Intronic
1190565962 X:51731096-51731118 CATTCATCATACCTAGAACTGGG - Intergenic
1191611537 X:63120262-63120284 CATCCAACAAACATGAAAAATGG + Intergenic
1192773564 X:74218427-74218449 CATTCAACAAACATTTAATGAGG + Intergenic
1194190690 X:90833694-90833716 CATTTACCAGACATAAAACATGG - Intergenic
1194455354 X:94096210-94096232 GTTTCAACAAACATAGGACTAGG - Intergenic
1195526198 X:105892567-105892589 CATTCAACTAACATAAACCCTGG - Intronic
1196553488 X:117059057-117059079 CATTCAGCAAACACAAAACATGG - Intergenic
1197221487 X:123918453-123918475 CATTAAACAAACATTACACATGG + Intergenic
1197339465 X:125248323-125248345 CATTTAACAAATGTAAAACATGG - Intergenic
1198604654 X:138323407-138323429 CATTCAACAGACATTTATCAAGG - Intergenic
1199321168 X:146440981-146441003 CATTCTACAAAGAGAAAACAGGG + Intergenic
1200001696 X:153065450-153065472 CGTTCAACACACATAGCACCTGG + Intergenic
1200537347 Y:4416115-4416137 CATTTACCAGACATAAAACATGG - Intergenic