ID: 996343522

View in Genome Browser
Species Human (GRCh38)
Location 5:122464993-122465015
Sequence CTGCTGGACTCGCACACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996343514_996343522 26 Left 996343514 5:122464944-122464966 CCCCACTGCACTAATGAACCTAC No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data
996343516_996343522 24 Left 996343516 5:122464946-122464968 CCACTGCACTAATGAACCTACAC No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data
996343515_996343522 25 Left 996343515 5:122464945-122464967 CCCACTGCACTAATGAACCTACA No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data
996343519_996343522 -9 Left 996343519 5:122464979-122465001 CCCTAGTGCACTGACTGCTGGAC No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data
996343520_996343522 -10 Left 996343520 5:122464980-122465002 CCTAGTGCACTGACTGCTGGACT No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data
996343517_996343522 8 Left 996343517 5:122464962-122464984 CCTACACTGTGCTGTCTCCCTAG No data
Right 996343522 5:122464993-122465015 CTGCTGGACTCGCACACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996343522 Original CRISPR CTGCTGGACTCGCACACAGG AGG Intergenic
No off target data available for this crispr