ID: 996345484

View in Genome Browser
Species Human (GRCh38)
Location 5:122483943-122483965
Sequence TCTAGGGCCCCTTGTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996345484_996345488 28 Left 996345484 5:122483943-122483965 CCTTTTTAACAAGGGGCCCTAGA No data
Right 996345488 5:122483994-122484016 GTTAATTTTATGTGTCAATTTGG 0: 29
1: 224
2: 526
3: 684
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996345484 Original CRISPR TCTAGGGCCCCTTGTTAAAA AGG (reversed) Intergenic
No off target data available for this crispr