ID: 996346949

View in Genome Browser
Species Human (GRCh38)
Location 5:122497923-122497945
Sequence GCTCTGGGGAAGGCAGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346949_996346957 29 Left 996346949 5:122497923-122497945 CCCAGCGCTGCCTTCCCCAGAGC No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data
996346949_996346956 28 Left 996346949 5:122497923-122497945 CCCAGCGCTGCCTTCCCCAGAGC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346949 Original CRISPR GCTCTGGGGAAGGCAGCGCT GGG (reversed) Intergenic