ID: 996346950

View in Genome Browser
Species Human (GRCh38)
Location 5:122497924-122497946
Sequence TGCTCTGGGGAAGGCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346950_996346956 27 Left 996346950 5:122497924-122497946 CCAGCGCTGCCTTCCCCAGAGCA No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346950_996346957 28 Left 996346950 5:122497924-122497946 CCAGCGCTGCCTTCCCCAGAGCA No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346950 Original CRISPR TGCTCTGGGGAAGGCAGCGC TGG (reversed) Intergenic