ID: 996346950 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:122497924-122497946 |
| Sequence | TGCTCTGGGGAAGGCAGCGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996346950_996346956 | 27 | Left | 996346950 | 5:122497924-122497946 | CCAGCGCTGCCTTCCCCAGAGCA | No data | ||
| Right | 996346956 | 5:122497974-122497996 | GTTTGTCACAGTAAGTGATGAGG | No data | ||||
| 996346950_996346957 | 28 | Left | 996346950 | 5:122497924-122497946 | CCAGCGCTGCCTTCCCCAGAGCA | No data | ||
| Right | 996346957 | 5:122497975-122497997 | TTTGTCACAGTAAGTGATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996346950 | Original CRISPR | TGCTCTGGGGAAGGCAGCGC TGG (reversed) | Intergenic | ||