ID: 996346951

View in Genome Browser
Species Human (GRCh38)
Location 5:122497933-122497955
Sequence GGCTGACATTGCTCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346951_996346958 25 Left 996346951 5:122497933-122497955 CCTTCCCCAGAGCAATGTCAGCC No data
Right 996346958 5:122497981-122498003 ACAGTAAGTGATGAGGGCCTCGG No data
996346951_996346957 19 Left 996346951 5:122497933-122497955 CCTTCCCCAGAGCAATGTCAGCC No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data
996346951_996346956 18 Left 996346951 5:122497933-122497955 CCTTCCCCAGAGCAATGTCAGCC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346951 Original CRISPR GGCTGACATTGCTCTGGGGA AGG (reversed) Intergenic