ID: 996346952

View in Genome Browser
Species Human (GRCh38)
Location 5:122497937-122497959
Sequence ACTTGGCTGACATTGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346952_996346958 21 Left 996346952 5:122497937-122497959 CCCCAGAGCAATGTCAGCCAAGT No data
Right 996346958 5:122497981-122498003 ACAGTAAGTGATGAGGGCCTCGG No data
996346952_996346956 14 Left 996346952 5:122497937-122497959 CCCCAGAGCAATGTCAGCCAAGT No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346952_996346957 15 Left 996346952 5:122497937-122497959 CCCCAGAGCAATGTCAGCCAAGT No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346952 Original CRISPR ACTTGGCTGACATTGCTCTG GGG (reversed) Intergenic