ID: 996346953 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:122497938-122497960 |
| Sequence | GACTTGGCTGACATTGCTCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996346953_996346956 | 13 | Left | 996346953 | 5:122497938-122497960 | CCCAGAGCAATGTCAGCCAAGTC | No data | ||
| Right | 996346956 | 5:122497974-122497996 | GTTTGTCACAGTAAGTGATGAGG | No data | ||||
| 996346953_996346957 | 14 | Left | 996346953 | 5:122497938-122497960 | CCCAGAGCAATGTCAGCCAAGTC | No data | ||
| Right | 996346957 | 5:122497975-122497997 | TTTGTCACAGTAAGTGATGAGGG | No data | ||||
| 996346953_996346958 | 20 | Left | 996346953 | 5:122497938-122497960 | CCCAGAGCAATGTCAGCCAAGTC | No data | ||
| Right | 996346958 | 5:122497981-122498003 | ACAGTAAGTGATGAGGGCCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996346953 | Original CRISPR | GACTTGGCTGACATTGCTCT GGG (reversed) | Intergenic | ||