ID: 996346953

View in Genome Browser
Species Human (GRCh38)
Location 5:122497938-122497960
Sequence GACTTGGCTGACATTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346953_996346956 13 Left 996346953 5:122497938-122497960 CCCAGAGCAATGTCAGCCAAGTC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346953_996346957 14 Left 996346953 5:122497938-122497960 CCCAGAGCAATGTCAGCCAAGTC No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data
996346953_996346958 20 Left 996346953 5:122497938-122497960 CCCAGAGCAATGTCAGCCAAGTC No data
Right 996346958 5:122497981-122498003 ACAGTAAGTGATGAGGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346953 Original CRISPR GACTTGGCTGACATTGCTCT GGG (reversed) Intergenic