ID: 996346955

View in Genome Browser
Species Human (GRCh38)
Location 5:122497954-122497976
Sequence AACTCACAGACTCTGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346955_996346958 4 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346958 5:122497981-122498003 ACAGTAAGTGATGAGGGCCTCGG No data
996346955_996346959 18 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346959 5:122497995-122498017 GGGCCTCGGTCTCCCCTTAGCGG No data
996346955_996346957 -2 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346957 5:122497975-122497997 TTTGTCACAGTAAGTGATGAGGG No data
996346955_996346960 19 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346960 5:122497996-122498018 GGCCTCGGTCTCCCCTTAGCGGG No data
996346955_996346956 -3 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346955 Original CRISPR AACTCACAGACTCTGTGACT TGG (reversed) Intergenic