ID: 996346956

View in Genome Browser
Species Human (GRCh38)
Location 5:122497974-122497996
Sequence GTTTGTCACAGTAAGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996346949_996346956 28 Left 996346949 5:122497923-122497945 CCCAGCGCTGCCTTCCCCAGAGC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346951_996346956 18 Left 996346951 5:122497933-122497955 CCTTCCCCAGAGCAATGTCAGCC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346953_996346956 13 Left 996346953 5:122497938-122497960 CCCAGAGCAATGTCAGCCAAGTC No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346950_996346956 27 Left 996346950 5:122497924-122497946 CCAGCGCTGCCTTCCCCAGAGCA No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346955_996346956 -3 Left 996346955 5:122497954-122497976 CCAAGTCACAGAGTCTGTGAGTT No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346952_996346956 14 Left 996346952 5:122497937-122497959 CCCCAGAGCAATGTCAGCCAAGT No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data
996346954_996346956 12 Left 996346954 5:122497939-122497961 CCAGAGCAATGTCAGCCAAGTCA No data
Right 996346956 5:122497974-122497996 GTTTGTCACAGTAAGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996346956 Original CRISPR GTTTGTCACAGTAAGTGATG AGG Intergenic