ID: 996347788

View in Genome Browser
Species Human (GRCh38)
Location 5:122506073-122506095
Sequence CCCTGTTTATGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996347788_996347794 13 Left 996347788 5:122506073-122506095 CCATCTTCCCTCCATAAACAGGG No data
Right 996347794 5:122506109-122506131 TGCCATTTCAGTGTTTCAGGTGG No data
996347788_996347793 10 Left 996347788 5:122506073-122506095 CCATCTTCCCTCCATAAACAGGG No data
Right 996347793 5:122506106-122506128 TGCTGCCATTTCAGTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996347788 Original CRISPR CCCTGTTTATGGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr