ID: 996348061

View in Genome Browser
Species Human (GRCh38)
Location 5:122509030-122509052
Sequence TTAAATCCTCAATAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996348058_996348061 15 Left 996348058 5:122508992-122509014 CCAGGCACCATGCAATACATATT No data
Right 996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG No data
996348059_996348061 8 Left 996348059 5:122508999-122509021 CCATGCAATACATATTACATGCA No data
Right 996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996348061 Original CRISPR TTAAATCCTCAATAAGAGCA AGG Intergenic
No off target data available for this crispr