ID: 996353100

View in Genome Browser
Species Human (GRCh38)
Location 5:122567457-122567479
Sequence GTGTCAGAAAAGAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996353100_996353107 20 Left 996353100 5:122567457-122567479 CCACCACACTTCTTTTCTGACAC No data
Right 996353107 5:122567500-122567522 CAAGTATCTTCATTCAAATGGGG No data
996353100_996353106 19 Left 996353100 5:122567457-122567479 CCACCACACTTCTTTTCTGACAC No data
Right 996353106 5:122567499-122567521 CCAAGTATCTTCATTCAAATGGG No data
996353100_996353104 18 Left 996353100 5:122567457-122567479 CCACCACACTTCTTTTCTGACAC No data
Right 996353104 5:122567498-122567520 TCCAAGTATCTTCATTCAAATGG No data
996353100_996353108 28 Left 996353100 5:122567457-122567479 CCACCACACTTCTTTTCTGACAC No data
Right 996353108 5:122567508-122567530 TTCATTCAAATGGGGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996353100 Original CRISPR GTGTCAGAAAAGAAGTGTGG TGG (reversed) Intergenic
No off target data available for this crispr