ID: 996355463

View in Genome Browser
Species Human (GRCh38)
Location 5:122591669-122591691
Sequence GCACCTAGGAAGCCAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996355463_996355467 -4 Left 996355463 5:122591669-122591691 CCCAGTTCTGGCTTCCTAGGTGC No data
Right 996355467 5:122591688-122591710 GTGCATTCCTAGAAGCTGCTGGG No data
996355463_996355471 15 Left 996355463 5:122591669-122591691 CCCAGTTCTGGCTTCCTAGGTGC No data
Right 996355471 5:122591707-122591729 TGGGGCATTGGAATATGTCCTGG No data
996355463_996355470 3 Left 996355463 5:122591669-122591691 CCCAGTTCTGGCTTCCTAGGTGC No data
Right 996355470 5:122591695-122591717 CCTAGAAGCTGCTGGGGCATTGG No data
996355463_996355466 -5 Left 996355463 5:122591669-122591691 CCCAGTTCTGGCTTCCTAGGTGC No data
Right 996355466 5:122591687-122591709 GGTGCATTCCTAGAAGCTGCTGG No data
996355463_996355468 -3 Left 996355463 5:122591669-122591691 CCCAGTTCTGGCTTCCTAGGTGC No data
Right 996355468 5:122591689-122591711 TGCATTCCTAGAAGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996355463 Original CRISPR GCACCTAGGAAGCCAGAACT GGG (reversed) Intergenic
No off target data available for this crispr