ID: 996366189

View in Genome Browser
Species Human (GRCh38)
Location 5:122703738-122703760
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996366188_996366189 -4 Left 996366188 5:122703719-122703741 CCATCACAGGATGACACAGGCCC No data
Right 996366189 5:122703738-122703760 GCCCCCAACAAAATTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr