ID: 996373453

View in Genome Browser
Species Human (GRCh38)
Location 5:122776745-122776767
Sequence TGTGAACTAGAATACTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996373450_996373453 12 Left 996373450 5:122776710-122776732 CCAGCGAGAATCAGAACAAACTT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 996373453 5:122776745-122776767 TGTGAACTAGAATACTGTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996373453 Original CRISPR TGTGAACTAGAATACTGTGA AGG Intronic
902162920 1:14546410-14546432 TGTCAACTAGTTTAATGTGAGGG + Intergenic
907647543 1:56259259-56259281 TGGGAATGAGAATTCTGTGAGGG - Intergenic
910088085 1:83428178-83428200 TCTGAATAAGAATACTCTGAGGG - Intergenic
911113768 1:94221440-94221462 TGTGATACTGAATACTGTGATGG + Intronic
912728869 1:112083647-112083669 TGTGAACGAGAAAACTATCAGGG - Intergenic
913066339 1:115259095-115259117 TGTGTTCTAGAATTCTGTCAAGG - Intergenic
916145898 1:161739119-161739141 TGTGAACATGAAGCCTGTGAGGG + Intergenic
916392999 1:164352975-164352997 TGTGAACTAAAATTCAGCGATGG + Intergenic
920568273 1:206994243-206994265 TGTGAAATAGAAAACTGGAATGG + Intergenic
923766532 1:236897190-236897212 TGTGAATGAGAATAAAGTGAGGG + Intronic
924198287 1:241633129-241633151 TGTAAATTAGAATACTGTGGTGG + Exonic
1066021803 10:31311271-31311293 TGTGAATTAGTGTTCTGTGAGGG - Intergenic
1066675692 10:37884740-37884762 TGTGAACTTGAATGATATGAGGG + Intergenic
1067127792 10:43534848-43534870 TGTGGACTAGCATACTGGAAAGG + Intergenic
1068632870 10:59315699-59315721 TGTGAACTAGAACACCATGAAGG + Intronic
1076090460 10:127681134-127681156 TGTGAAATAAAATAATGTGTAGG - Intergenic
1086730498 11:90242856-90242878 CGTGAGCTAGAGTACTCTGAAGG - Intergenic
1090585283 11:128205321-128205343 TGTGAATTAGGATGCTGTAAGGG - Intergenic
1091989794 12:4946167-4946189 TGTGAGATAGAATGATGTGAAGG + Intergenic
1093608600 12:21126365-21126387 TGGGTACTAGAATATGGTGAGGG + Intronic
1094646976 12:32335030-32335052 TCTGAAATAGAGTTCTGTGAAGG + Intronic
1101638630 12:106568631-106568653 TATGAAATAGATTGCTGTGAAGG - Intronic
1102820212 12:115902102-115902124 TGGGAAGGAGAATCCTGTGATGG + Intergenic
1103206794 12:119136058-119136080 TGGCAACTAGGATACTTTGAGGG - Intronic
1104395775 12:128431273-128431295 TGTGAAAAAGAATTCTGTGAAGG + Intronic
1104518064 12:129446160-129446182 TGAGAACCAGAATACTGAGCTGG + Intronic
1104803905 12:131572703-131572725 TGTGACATAGCATCCTGTGAAGG - Intergenic
1108478854 13:50846639-50846661 GGTGAACTAGAATTCAGTGTAGG + Intergenic
1109867515 13:68284761-68284783 TCTGAACTAGAATTCTTTAAAGG + Intergenic
1111926516 13:94469033-94469055 TGTGAACTAGGAAACTTTGCCGG - Exonic
1112985588 13:105445341-105445363 TGTGGATTAGAAAACTGTGAAGG - Intergenic
1121210775 14:92206838-92206860 TGTGAACCTGAAAACTGTCAAGG + Intergenic
1121735015 14:96212110-96212132 TGCGAAAAAGAATACAGTGAGGG - Intronic
1123201386 14:106668503-106668525 TGGAAACTAGAATAATGTTATGG + Intergenic
1131623353 15:94090879-94090901 TGTGAAAAATAATACTGTTAAGG - Intergenic
1138975272 16:62199084-62199106 TTTAAACTAGAATGCTGTGCAGG - Intergenic
1139120335 16:64008681-64008703 TCTGTACTTTAATACTGTGATGG + Intergenic
1140819865 16:78652884-78652906 TGTGAACTCCAGAACTGTGATGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1150181900 17:63131195-63131217 TGTGAACTTAAAAACTGTGGTGG - Intronic
1152574907 17:81135713-81135735 CGTGAGCTAGAAGACAGTGAGGG + Intronic
1153131736 18:1861460-1861482 TGTGACTTGGAATGCTGTGATGG - Intergenic
1155468100 18:26161552-26161574 TGTTTTCTAGAATACTATGATGG + Intronic
1158597272 18:58827461-58827483 TGTGAACTGTAACACTGTGAAGG - Intergenic
1161860537 19:6794882-6794904 TGGGAACTAGAATGCTCTGGAGG + Intronic
1164469920 19:28521714-28521736 AGTGAACTAGATTTCTGTGGAGG + Intergenic
1166369827 19:42294503-42294525 TGTGAAATAGAATGCAGTGAGGG + Intronic
926805805 2:16709793-16709815 ATGGAACTAGAATATTGTGATGG - Intergenic
929418145 2:41764780-41764802 TATGAACTATAACACTGTGGAGG + Intergenic
930589765 2:53313182-53313204 TGTGAATTCAGATACTGTGATGG - Intergenic
932992406 2:76803750-76803772 TGGGAACTTGGATATTGTGAAGG + Intronic
933415982 2:81986310-81986332 TAAGAACTGTAATACTGTGAGGG + Intergenic
934133626 2:88972719-88972741 TCTGAGCTATAACACTGTGAGGG + Intergenic
939260201 2:139797775-139797797 TGTGAAATAGAAGACAGTGCAGG + Intergenic
940049940 2:149451495-149451517 TGTGAACTGGTATTCTGTGTAGG + Intronic
940134701 2:150423159-150423181 TGTGAATTAGACTTCTTTGATGG - Intergenic
940333094 2:152496645-152496667 TATGAGTTAGAATTCTGTGAGGG + Intronic
940779754 2:157919939-157919961 TGTGTACTAAAATACTAAGAGGG + Intronic
942934475 2:181538369-181538391 TGTAATCTAGAAAACTGAGAAGG + Intronic
946472500 2:219975268-219975290 TGTGAACCAGAAAACTGTGTAGG - Intergenic
946587519 2:221207040-221207062 TGTGGACTAGAAAAATGTGAAGG + Intergenic
1168780098 20:481888-481910 TATGCCCTAGAATGCTGTGAGGG - Exonic
1170013058 20:11748867-11748889 TGTGAACTAGAATCCCTTCAGGG - Intergenic
1170252235 20:14296842-14296864 TGTGAAGTATAATAAAGTGAAGG - Intronic
1177125835 21:17192214-17192236 TGATAACTAGACTTCTGTGAAGG - Intergenic
1177209340 21:18050663-18050685 TGTGAAGGAGAAAACTGGGAGGG + Intronic
1177698559 21:24606531-24606553 TGTGAACTAGAGCACAATGAGGG - Intergenic
950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG + Intergenic
951354223 3:21644393-21644415 TGTGAACCTGCATTCTGTGATGG - Intronic
952068415 3:29601724-29601746 CATTAATTAGAATACTGTGAGGG + Intronic
955649825 3:61182041-61182063 TGTGAAATCGGATACTCTGAAGG + Intronic
956541537 3:70345187-70345209 TGAGAACTAGATTACTCTGTTGG - Intergenic
962988839 3:140560365-140560387 TGTGAACTAACAGAGTGTGAGGG - Intronic
963331641 3:143922215-143922237 TGTTATATGGAATACTGTGACGG + Intergenic
967469712 3:189847576-189847598 TCAGAAATAAAATACTGTGATGG - Intronic
967502197 3:190211480-190211502 TGAAAACTATAAAACTGTGATGG + Intergenic
967853623 3:194100273-194100295 TGTGAAGTAGCTTCCTGTGAAGG - Intergenic
971388453 4:26162786-26162808 TGTGAACTAGAATACAGTCTAGG - Intergenic
971506497 4:27371843-27371865 TGTGAACTTGAATACAGTCAAGG + Intergenic
973309967 4:48698525-48698547 TGTGAAAGAAAATACTGTGCTGG + Intronic
974133069 4:57780312-57780334 TGAGAAATAGAAGACAGTGATGG + Intergenic
978183742 4:105833826-105833848 TATGAATTAGAATACTGAGTGGG - Intronic
978649491 4:110983320-110983342 TATGTACTAGAAACCTGTGAAGG - Intergenic
981212845 4:142129424-142129446 TGTGAACATTAATAATGTGAAGG + Intronic
984506367 4:180624035-180624057 GGTGAAGTAGATGACTGTGAGGG + Intergenic
993161653 5:84299055-84299077 TGAGAAATGAAATACTGTGAAGG + Intronic
995967678 5:117928824-117928846 TGTGAACTAGAAGATTTTGGAGG - Intergenic
996373453 5:122776745-122776767 TGTGAACTAGAATACTGTGAAGG + Intronic
998984529 5:147740974-147740996 AGTGGTCTAGGATACTGTGAAGG - Intronic
1002784058 6:388119-388141 TGTGAAGAAGAATAAAGTGAAGG + Intergenic
1004952167 6:20685737-20685759 TAAGAACTAGCAGACTGTGATGG - Intronic
1004970085 6:20900082-20900104 TGAAGACTAGAATACTGAGAAGG - Intronic
1006345356 6:33476869-33476891 TATTAACTAGAATTCTGTGAAGG - Intergenic
1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG + Intronic
1008182267 6:48345457-48345479 TGTGAGTTAGAATATTGTCATGG + Intergenic
1009291225 6:61885465-61885487 TGTGAACTACAACACTGATACGG - Intronic
1009649820 6:66461240-66461262 TGAGATCTAGAATTCTTTGACGG - Intergenic
1011617606 6:89211401-89211423 TGTGAACTGAAAGACTGAGATGG - Intronic
1011936715 6:92787868-92787890 TCTCAACTGGAAGACTGTGATGG - Intergenic
1016427545 6:143950322-143950344 CATGAACTAGAATACTGGAAGGG - Intronic
1017132735 6:151121989-151122011 TGGGAACTGGAATCCTCTGAAGG + Intergenic
1025214970 7:57048686-57048708 TGTGAACTAGAAAAATGAAAAGG - Intergenic
1025656982 7:63528131-63528153 TGTGAACTAGAAAAATGAAAAGG + Intergenic
1027304959 7:76884615-76884637 TCTGAATAAGAATACTCTGAGGG - Intergenic
1027723520 7:81773298-81773320 TGTGAAGTACAATAAAGTGAAGG - Intergenic
1027882142 7:83854179-83854201 TGTAAACAAGAAGAATGTGATGG + Intergenic
1034078389 7:148254060-148254082 GGTGAACTACATTTCTGTGAGGG + Intronic
1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG + Intronic
1037078998 8:14759654-14759676 TGTGAGCTGAAATACTGTCATGG - Intronic
1038344923 8:26723695-26723717 TGAGCACTATAATGCTGTGACGG + Intergenic
1038769548 8:30464422-30464444 TGTGAACTAGAAAGCTGGGGTGG - Intronic
1038853133 8:31299956-31299978 GGTCAACACGAATACTGTGAAGG + Intergenic
1042009235 8:64221417-64221439 TGTGAACTAGAATCGTGATATGG - Intergenic
1044086134 8:87944151-87944173 CGTGGACTGGAACACTGTGAGGG - Intergenic
1044506894 8:93031418-93031440 TGTGAATTAAAAAAGTGTGAAGG + Intergenic
1044849492 8:96414392-96414414 TGTTAACTAGAATATTGTCTTGG - Intergenic
1046290423 8:112152608-112152630 TTTGAAGTAGAAGAATGTGAAGG - Intergenic
1047214291 8:122864184-122864206 GGTGATCTAGAATGCTGTGAGGG + Intronic
1047740888 8:127805795-127805817 TATGTACTAGAATAATATGAAGG + Intergenic
1050272889 9:3965026-3965048 TATGAAATAAAATACTCTGAGGG + Intronic
1052440735 9:28493641-28493663 TGTCAACTTGATTACAGTGAAGG + Intronic
1054344700 9:63902474-63902496 GGTCATCTGGAATACTGTGACGG + Intergenic
1054852369 9:69861118-69861140 TGTCAACAAGACTACTGTGCTGG - Intronic
1055459642 9:76506566-76506588 TGTGAACAAAAATTTTGTGATGG + Exonic
1058776373 9:108287891-108287913 TATGAACTAAAATATTATGAAGG - Intergenic
1060101590 9:120845352-120845374 TGTGAGCCAGTATTCTGTGATGG + Intergenic
1188308216 X:28585366-28585388 GGTCAACTAGAGGACTGTGATGG + Intergenic
1188832934 X:34923134-34923156 TGTGAACTTGACTCATGTGAAGG - Intergenic
1193444653 X:81585890-81585912 TGTGGACTAGAATCTTGTGTAGG - Intergenic
1195223308 X:102767239-102767261 TGTGAATTAAGATACTGAGAGGG + Intergenic
1197230231 X:123995951-123995973 TGTGAAGTAGAATTTTGTGTAGG + Intronic
1201271599 Y:12261095-12261117 TGTGAGCTGAAACACTGTGAGGG - Intergenic