ID: 996373457

View in Genome Browser
Species Human (GRCh38)
Location 5:122776764-122776786
Sequence AAGGCTAAGCATTCTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996373451_996373457 2 Left 996373451 5:122776739-122776761 CCCTAGTGTGAACTAGAATACTG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG No data
996373452_996373457 1 Left 996373452 5:122776740-122776762 CCTAGTGTGAACTAGAATACTGT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996373457 Original CRISPR AAGGCTAAGCATTCTGTTGG GGG Intronic
No off target data available for this crispr