ID: 996376105

View in Genome Browser
Species Human (GRCh38)
Location 5:122809364-122809386
Sequence TGTAGAGTCAAGTACTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996376105_996376109 28 Left 996376105 5:122809364-122809386 CCTTTAGAGTACTTGACTCTACA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 996376109 5:122809415-122809437 TCCTTGAAGCAGACTAAAAGGGG No data
996376105_996376111 29 Left 996376105 5:122809364-122809386 CCTTTAGAGTACTTGACTCTACA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 996376111 5:122809416-122809438 CCTTGAAGCAGACTAAAAGGGGG No data
996376105_996376108 27 Left 996376105 5:122809364-122809386 CCTTTAGAGTACTTGACTCTACA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 996376108 5:122809414-122809436 TTCCTTGAAGCAGACTAAAAGGG 0: 1
1: 0
2: 0
3: 18
4: 275
996376105_996376107 26 Left 996376105 5:122809364-122809386 CCTTTAGAGTACTTGACTCTACA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 996376107 5:122809413-122809435 CTTCCTTGAAGCAGACTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996376105 Original CRISPR TGTAGAGTCAAGTACTCTAA AGG (reversed) Intronic
902434600 1:16390075-16390097 TCTAGAGACAAGATCTCTAATGG - Intronic
909323797 1:74323958-74323980 TGTGGTGTCAAGCAATCTAAGGG + Intronic
909377463 1:74956198-74956220 TGTAGAGTGAAGTATTAAAAGGG + Intergenic
911111416 1:94191430-94191452 TGCAGAGTCAAGTATCCTTAGGG - Intronic
911304504 1:96216390-96216412 TGTAGACTCAAGAACTCAAGAGG + Intergenic
912181733 1:107227023-107227045 TATAGAGTAAAGCACTCAAATGG - Intronic
913490482 1:119375215-119375237 GGAAGATTCAAGTAATCTAATGG - Intronic
923974320 1:239243367-239243389 TGTGGGGGCAAGTACTCTTAAGG - Intergenic
1069122761 10:64588146-64588168 TATACAGTCAAATACTCTATTGG - Intergenic
1069511621 10:69046868-69046890 TGTAGACTCAGCTACTCTGAAGG + Intergenic
1074983238 10:118636098-118636120 CATAGAGACTAGTACTCTAAGGG - Intergenic
1076111959 10:127866805-127866827 TGTAGAGTCCAATAGTCCAATGG + Intergenic
1078549646 11:12271282-12271304 TGGAGAATGAAGGACTCTAATGG - Intergenic
1078853293 11:15183706-15183728 TGAAGAGCCAAAGACTCTAAAGG + Intronic
1080760399 11:35243554-35243576 TGTAGTCTCAACTACTCTCAAGG + Intergenic
1082139465 11:48591264-48591286 CAAAGAGTTAAGTACTCTAAAGG - Intergenic
1085325034 11:75600120-75600142 AGTACTTTCAAGTACTCTAAAGG + Intronic
1085657946 11:78333801-78333823 TGTGGTGTCAGGTAATCTAAAGG - Intronic
1090156850 11:124447779-124447801 TGTAGAGTCAACTACTTGGAAGG + Intergenic
1094351803 12:29534779-29534801 CATAGAGTCAAATATTCTAACGG + Intronic
1098502772 12:71212991-71213013 TGTAGATTCAGGCACTCTAAGGG - Intronic
1107462816 13:40620492-40620514 TGGAGAATCTAGTACTCTAAGGG + Intronic
1108474056 13:50796131-50796153 TATAGAGTTCAGTACTCTAAGGG - Intronic
1108996672 13:56743086-56743108 AGTAGATTCAGGTACTCTGATGG - Intergenic
1114902085 14:27074640-27074662 TGTAGAGTTAATTACTGAAACGG + Intergenic
1116135138 14:40913711-40913733 TTTAGAGTCAGTTGCTCTAATGG - Intergenic
1116822223 14:49636380-49636402 TATTGTGTCAAATACTCTAAGGG - Intergenic
1126420804 15:48470132-48470154 TGTTGAGCCAAGGACTCTCAGGG - Intronic
1128991825 15:72267254-72267276 AGGAGAGTTAAGTACTTTAAAGG - Intronic
1136025524 16:27465848-27465870 TGTAAAGTCCAGTGCTCTGACGG + Intronic
1137443723 16:48518852-48518874 TGTAGTTTCAAGTACTCAAAAGG + Intergenic
1137460073 16:48652731-48652753 TGTAGTCTCAACTACTCAAAAGG + Intergenic
1138132303 16:54490936-54490958 TGTATGGTCAAGTACCCAAAGGG - Intergenic
1143911106 17:10250132-10250154 TGTAAAGTAGACTACTCTAAGGG + Intergenic
1149400234 17:56288726-56288748 TGGGGAGTCTACTACTCTAAAGG - Intronic
1149766491 17:59283153-59283175 TGTAGTCTCAGCTACTCTAAAGG - Intergenic
1157981981 18:52392437-52392459 TGTATAGTGAAGTCTTCTAATGG + Intronic
1166211547 19:41309712-41309734 TGTAGTCCCAAGTACTCCAAAGG + Intronic
931281258 2:60793962-60793984 TGTAGAGTCAACTTCTGAAAAGG - Exonic
931636950 2:64349433-64349455 TGCAGAGACAAGTTCTCTGAGGG + Intergenic
931752379 2:65341307-65341329 TGTGGAGTCAAGGAATGTAAAGG + Intronic
937436399 2:121885232-121885254 TGTGGAGGCATGGACTCTAAGGG + Intergenic
944057046 2:195533632-195533654 TATAGAGTCAAGGACAGTAAAGG + Intergenic
944600508 2:201298183-201298205 TGTGGTGTCAAGTACTCAGAGGG + Intronic
944924076 2:204445405-204445427 TGTACATTCAAGGACTCAAAGGG + Intergenic
945921447 2:215759051-215759073 TGTAGAGTGATGAAATCTAAAGG - Intergenic
1171920745 20:31096640-31096662 TCTACAGTAATGTACTCTAATGG + Intergenic
1171929245 20:31214800-31214822 TCTACAGTAATGTACTCTAATGG + Intergenic
953678161 3:45019349-45019371 TGTAGAGCCAGGTACTCTGGAGG - Intronic
953903290 3:46855231-46855253 TGTAGAGTCCACTTATCTAAGGG - Intergenic
956383562 3:68692185-68692207 TGGACAGTCTAGAACTCTAAAGG - Intergenic
957770986 3:84692236-84692258 TCTAGAGACAAGTTCTCTCATGG + Intergenic
961706988 3:128794762-128794784 TGCAGAGTCAAGTATTCAGACGG + Intronic
969872346 4:10112446-10112468 TGTAGAGTGAAAGACTATAATGG - Intronic
970595513 4:17596696-17596718 TCTAGAATCAAGAAATCTAAAGG - Intronic
971378015 4:26070524-26070546 TGTAGACTCAATTATTCAAAGGG + Intergenic
972182075 4:36479513-36479535 TGTAGAGGCAAGTGCTTTATGGG - Intergenic
973850531 4:54957222-54957244 TGAAGAGTCAAGTAACCTCATGG + Intergenic
979390765 4:120124921-120124943 TGGAGTGTCAAGTACTCTCTGGG + Intergenic
984303058 4:177948911-177948933 TGCAGAGTCACGTTCTCAAAAGG + Intronic
984621560 4:181958740-181958762 TGTATAATCAAGTATTCTAGTGG - Intergenic
987601277 5:20074790-20074812 TCTACAGTCAAGTATTCTGAAGG + Intronic
987972925 5:24973860-24973882 TGTTTGGTCAAGTATTCTAATGG - Intergenic
988498447 5:31764383-31764405 TCTAGAGGCAAATCCTCTAAGGG - Intronic
989264011 5:39451267-39451289 TCTAGATTCCAGTACTCTGAGGG + Intronic
989478571 5:41902444-41902466 TTTAGAGTCAAATATTCAAAAGG - Intergenic
989607253 5:43256390-43256412 AGAAGAGTCAAATACTCAAAAGG + Intronic
990583431 5:57186687-57186709 TGTAGTCTCAACTACTCAAAAGG - Intronic
994349797 5:98731603-98731625 TGTAAAATCAAGCTCTCTAATGG + Intergenic
995429300 5:112056459-112056481 TTTAAAGTCAAGTAATGTAATGG - Intergenic
996376105 5:122809364-122809386 TGTAGAGTCAAGTACTCTAAAGG - Intronic
996536830 5:124585984-124586006 TGAAAAGTCAAGTACTCTTAGGG - Intergenic
998598323 5:143558015-143558037 AATGGAGTCAAGTGCTCTAATGG + Intergenic
999457678 5:151731431-151731453 TGTAGTCTCAGCTACTCTAAAGG + Intergenic
1003219035 6:4140791-4140813 TGTAGTGTCAACTACTCTGGAGG - Intergenic
1003954519 6:11149388-11149410 TATAGAGTCAAATATTCTATTGG + Intergenic
1014129493 6:117814286-117814308 GGTAGAGTCAAGAAATCTAAAGG - Intergenic
1017915249 6:158826413-158826435 TGCAGAGTCAAGTTCTCTGAAGG - Intergenic
1020269500 7:6585479-6585501 TGTAGAGACAAGGTCTCTACAGG - Intronic
1021010869 7:15464171-15464193 TGCAGAAACAAGAACTCTAATGG - Intronic
1026075511 7:67163529-67163551 TGAAGAGTCATGTACTCTACAGG - Intronic
1026322867 7:69282686-69282708 TGTAGTCTCAGGTACTCTAGAGG + Intergenic
1026701343 7:72648682-72648704 TGAAGAGTCATGTACTCTACAGG + Intronic
1026841456 7:73671651-73671673 AGTTGAGTCAAGTTCTTTAACGG - Exonic
1027636061 7:80676023-80676045 TGCAGAGAGAAGTTCTCTAACGG - Intronic
1030019273 7:105256996-105257018 TGCAGTGCTAAGTACTCTAATGG - Intronic
1030943543 7:115686239-115686261 TGCAAAGTCAGGTAGTCTAATGG + Intergenic
1031758284 7:125675047-125675069 TGTACAGTAGAGTATTCTAAAGG - Intergenic
1041451832 8:58013805-58013827 GGTAGACTCAGGTACTCTCAGGG + Intronic
1043196404 8:77297988-77298010 TCAAGATTCAAATACTCTAAAGG - Intergenic
1044345761 8:91102608-91102630 TGTATAATAAAGAACTCTAATGG + Intronic
1045245171 8:100436320-100436342 TGTGAAGTCAAGTCCTCTATTGG + Intergenic
1046221579 8:111223749-111223771 TGTTTAGTCAAATAGTCTAAAGG - Intergenic
1051095362 9:13459874-13459896 TTTTGTGTCAAGTACTCTACTGG + Intergenic
1203752854 Un_GL000218v1:96761-96783 TGAAGACTGAAGTACTCTTAAGG + Intergenic
1193608868 X:83603948-83603970 TGTAGAGTCTAGAAATCTCAGGG + Intergenic
1193711538 X:84886300-84886322 TCTATAGCCAAGTACTATAATGG - Intergenic
1194871036 X:99131469-99131491 TTTAAAATCAAGTACACTAAAGG + Intergenic
1197406310 X:126055970-126055992 TTTAGAGGTAAGTATTCTAAAGG + Intergenic
1197461076 X:126741853-126741875 AGTAAAGTCAAGTTCACTAAAGG - Intergenic
1197498898 X:127220227-127220249 TGTAGAGGCCAGTATCCTAAGGG - Intergenic