ID: 996376106

View in Genome Browser
Species Human (GRCh38)
Location 5:122809392-122809414
Sequence AGACAAGTCTTCAAAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996376106_996376108 -1 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376108 5:122809414-122809436 TTCCTTGAAGCAGACTAAAAGGG 0: 1
1: 0
2: 0
3: 18
4: 275
996376106_996376113 10 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376113 5:122809425-122809447 AGACTAAAAGGGGGACAGATGGG No data
996376106_996376116 18 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376116 5:122809433-122809455 AGGGGGACAGATGGGAGGATGGG 0: 1
1: 0
2: 2
3: 83
4: 730
996376106_996376107 -2 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376107 5:122809413-122809435 CTTCCTTGAAGCAGACTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 124
996376106_996376114 13 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376114 5:122809428-122809450 CTAAAAGGGGGACAGATGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 253
996376106_996376111 1 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376111 5:122809416-122809438 CCTTGAAGCAGACTAAAAGGGGG No data
996376106_996376112 9 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376112 5:122809424-122809446 CAGACTAAAAGGGGGACAGATGG 0: 1
1: 0
2: 0
3: 16
4: 253
996376106_996376109 0 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376109 5:122809415-122809437 TCCTTGAAGCAGACTAAAAGGGG No data
996376106_996376115 17 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376115 5:122809432-122809454 AAGGGGGACAGATGGGAGGATGG 0: 1
1: 1
2: 6
3: 131
4: 1560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996376106 Original CRISPR AGACAAGTCTTCAAAGCTAT AGG (reversed) Intronic
900705375 1:4077003-4077025 AGACAAGTCTTTAAAACAAATGG - Intergenic
905279355 1:36839069-36839091 AAACAGCTCTTCAAAGCTGTGGG + Intronic
911460789 1:98187486-98187508 GGAGAAGTCTTGAAACCTATGGG + Intergenic
913106531 1:115618881-115618903 ATCAAAGTATTCAAAGCTATAGG + Intergenic
917563609 1:176187077-176187099 ATACATTTCTTAAAAGCTATTGG - Intronic
917989185 1:180355532-180355554 GAACATGACTTCAAAGCTATGGG - Intronic
918406071 1:184213109-184213131 AGGCAAGTCCTGAAAGCTGTGGG - Intergenic
923984580 1:239366870-239366892 AGACAAATCTTTGAAGATATAGG - Intergenic
924118248 1:240769244-240769266 AGACAGGTCTTCAAAGCATGCGG + Intergenic
924190728 1:241549739-241549761 CGACAAGCCTTGAAAGCTGTTGG + Exonic
1063095198 10:2902980-2903002 AGAAAAGTCCTAAAAGTTATAGG - Intergenic
1064138336 10:12769370-12769392 CCACAAGTCTGCAAAGCAATCGG + Intronic
1064815700 10:19259466-19259488 AGTCAAGTCTTACAAGTTATAGG + Intronic
1066645233 10:37600514-37600536 AGACAAGTCTACCAAGCAAATGG - Intergenic
1070268070 10:74924054-74924076 AGAGAAGACTTCAAGGTTATTGG + Intronic
1072906813 10:99461782-99461804 ATACAAGATTTCAAAGATATTGG - Intergenic
1073683058 10:105725832-105725854 AGACAAGTCCTCAAAAATAATGG - Intergenic
1075064612 10:119281116-119281138 AGAAAAGTCCTGAAAGCAATGGG - Intronic
1075505990 10:123023092-123023114 AGCCAAGTCTTCTGAGTTATCGG - Intronic
1079309767 11:19354908-19354930 AGGTAAGTCTTCAAAGGAATAGG - Intronic
1079606206 11:22370833-22370855 AGACATTTGTTCAGAGCTATGGG + Intronic
1080060828 11:27954976-27954998 AGAATAGTGTTCAAAGATATTGG - Intergenic
1080161048 11:29176838-29176860 AGACCAGTCTCCATAGATATTGG - Intergenic
1087715956 11:101609069-101609091 AGACAAGTTTTAAAAAATATTGG - Intronic
1088382761 11:109215003-109215025 AAACAAGTCTTGAAAGCAACTGG - Intergenic
1090532390 11:127604718-127604740 AGGTAAGTCCTCAAAGCCATTGG - Intergenic
1093285834 12:17261425-17261447 AGAAAAGTCTAAAAAGCTCTTGG - Intergenic
1093326153 12:17777265-17777287 AGACAAATCTTTAAAATTATAGG - Intergenic
1097471049 12:59991755-59991777 AGAAAAATCATCAATGCTATTGG + Intergenic
1098834890 12:75412074-75412096 AGAGAAGTATTGAATGCTATTGG - Intronic
1100590746 12:96026064-96026086 AGAAAATTCTCCAAAGATATAGG + Intronic
1103073447 12:117963649-117963671 ATAGAAGTCTTCAAAGGTTTTGG - Intronic
1104183548 12:126406031-126406053 TGAAAAGTCTTCAAATCTATTGG + Intergenic
1106305486 13:28505509-28505531 AGAGAAGTCTTTTAAGCTAAAGG - Intergenic
1107922407 13:45222849-45222871 AATCAAGTCTTAAAAGCTAAAGG - Intronic
1109368389 13:61388693-61388715 AGAAAAGTTTGCAAAGCTGTTGG - Intergenic
1111416953 13:87959259-87959281 AGACATGTTTTCAGACCTATTGG + Intergenic
1111435191 13:88197349-88197371 AAATAAGTCCTCAAATCTATGGG - Intergenic
1113259180 13:108542731-108542753 AGAACACTCTTCAAAACTATAGG - Intergenic
1114805002 14:25825035-25825057 AGAAAAGTCTACAAGGATATAGG + Intergenic
1115925373 14:38427653-38427675 AGACAAGTCTGCAGAGCAAGGGG + Intergenic
1117678076 14:58175241-58175263 AAACAAGTGTTCAAAGGAATGGG - Intronic
1118126094 14:62905964-62905986 AGGCAAATTTTCAAACCTATGGG - Intronic
1118663249 14:68037849-68037871 AGTTAAGTCTTCAAAGCTCAGGG - Intronic
1118670154 14:68116794-68116816 AGAAAAGTCTATAAAGCTACAGG + Intronic
1124807678 15:32902692-32902714 AGACAGATCTTAAAAGCTAAAGG + Intronic
1126263226 15:46719360-46719382 AAAAAAGTTTTCAATGCTATTGG + Intergenic
1131877174 15:96820927-96820949 AAAAAAGTCTTCAAAGGAATTGG - Intergenic
1132720394 16:1312769-1312791 AGCCAGGTCTTCTAAGCTGTGGG - Intronic
1134421321 16:14092425-14092447 TGACAACTCTTGAAAGTTATTGG + Intronic
1141448830 16:84082782-84082804 AAAGAAGTGCTCAAAGCTATGGG + Intronic
1149334689 17:55623537-55623559 AAGCAATGCTTCAAAGCTATTGG - Intergenic
1153835460 18:8959984-8960006 AGACAAATATTCAAAGCTCAAGG + Intergenic
1156257593 18:35412386-35412408 AGAGGAGTCATCAAAGCCATGGG - Intergenic
1156602679 18:38628262-38628284 AGAAAAGTGTTCTAAGTTATTGG + Intergenic
926929387 2:18022417-18022439 AGACAAGAGGACAAAGCTATGGG - Intronic
931020494 2:58039432-58039454 AGACAAGAATTCAATCCTATTGG - Intronic
932282899 2:70509947-70509969 TGACAGGTGTTCTAAGCTATAGG + Intronic
933066720 2:77807517-77807539 AGCCAGGTCTTCTAGGCTATAGG - Intergenic
936744793 2:115561924-115561946 AGAAACGACTTCAAAGATATAGG - Intronic
938793537 2:134698340-134698362 ATCCAAGTCTTCAAATTTATGGG + Intronic
939176542 2:138754673-138754695 AAATAAGTTTTCAAACCTATTGG + Intronic
940953092 2:159699026-159699048 AGACAATCCTTGCAAGCTATAGG - Intergenic
943619684 2:190134941-190134963 TTATAACTCTTCAAAGCTATGGG + Intronic
947149195 2:227097464-227097486 AGTCAAGATTTGAAAGCTATTGG + Intronic
1169526713 20:6436080-6436102 AGACAATTTGTCAAAGATATTGG + Intergenic
1170907302 20:20527958-20527980 AGACAAGACACAAAAGCTATGGG + Intronic
1173237154 20:41257032-41257054 AGAAAAATCTTAAAAGCTAGAGG - Intronic
1174670911 20:52306893-52306915 ATAAAAGCCTTCAGAGCTATTGG + Intergenic
1175955094 20:62605053-62605075 AGACAGGGCTCCAAAGCTATGGG - Intergenic
1178668942 21:34573506-34573528 AGATAGGTCTTCAAGGCTCTGGG + Intronic
1182573338 22:31255427-31255449 AGACAAGTAGGAAAAGCTATAGG + Intronic
949463792 3:4322844-4322866 AGACATGTTTTCAATTCTATTGG - Intronic
949742846 3:7256145-7256167 AGACAAGTAAGCAAAGCTCTGGG - Intronic
953937869 3:47061846-47061868 AGATAAGTCTTCAAAGATAATGG - Intronic
957117430 3:76044403-76044425 AGACAAGTTTTCAGATTTATTGG + Intronic
957897576 3:86443726-86443748 AGACAAGACTTCAAAGATATTGG - Intergenic
958508255 3:95010776-95010798 AGACAAATATTTAAATCTATAGG - Intergenic
959284860 3:104395457-104395479 ACTCAAGTGTTAAAAGCTATTGG - Intergenic
959442893 3:106400356-106400378 AGCCAAAGCTTCAAAGCCATTGG - Intergenic
963205197 3:142626769-142626791 AAATATGTCTTCAAAGCAATTGG - Intronic
964261057 3:154837231-154837253 ATAAAAATGTTCAAAGCTATGGG + Intergenic
967193674 3:187007460-187007482 AGATCAGTTTTCAAAGCTTTTGG - Intronic
970291713 4:14580011-14580033 AGACAAGTAGACAAAGCCATAGG + Intergenic
970508090 4:16753429-16753451 AGTCAATACTGCAAAGCTATTGG + Intronic
971378717 4:26077131-26077153 AGACGAGTCTTCAAGGAAATGGG - Intergenic
971803301 4:31320495-31320517 ATAACAGTCTTCAAAGTTATTGG + Intergenic
974163289 4:58167991-58168013 AGAAAAGTCCTCAAATCTATGGG + Intergenic
975436460 4:74358275-74358297 AGGCAAGTGTGCAAAGGTATTGG - Intergenic
977519107 4:98058151-98058173 ATACAAGTCTTCAAAATAATCGG + Intronic
978531968 4:109724085-109724107 ACACATGTCTTTAAAGCCATAGG - Intronic
978672426 4:111266386-111266408 ATACAGGTCTTAAAAGCTCTTGG - Intergenic
979511898 4:121563991-121564013 AGAACTGTCTCCAAAGCTATTGG + Intergenic
981946312 4:150348375-150348397 AGACAAGTCTTTTAAGTAATAGG + Intronic
984321649 4:178204798-178204820 ATACATTTCTTCAAACCTATAGG + Intergenic
985730832 5:1547623-1547645 AGACCTGTCTTCAGGGCTATTGG + Intergenic
986662333 5:10070542-10070564 AGAAAAGCCTTCAAAGCCCTGGG + Intergenic
986834780 5:11623632-11623654 AGAAAAATCTTCAAAGCAAATGG + Intronic
987441248 5:17959705-17959727 AGTCAAATCTTCTGAGCTATTGG + Intergenic
987645717 5:20670545-20670567 AGAAATGTCTTCAAATCTCTAGG + Intergenic
989042030 5:37239201-37239223 AGCCAAGTTTTGAAAGTTATGGG + Intronic
990388489 5:55292842-55292864 AGTCAAGACTTCAAAGAGATGGG - Intronic
990769369 5:59225247-59225269 AGAAAAGTCTTGAATGGTATTGG - Intronic
993024333 5:82628347-82628369 AGACATTTCTTGTAAGCTATTGG + Intergenic
994091995 5:95817832-95817854 AGACTATTTTTCAAAGCTTTGGG + Intronic
994236651 5:97370330-97370352 AGAAAAGTCATCAAAGATAAAGG - Intergenic
995156930 5:108926582-108926604 AGATAAATCATCAAGGCTATGGG - Intronic
996376106 5:122809392-122809414 AGACAAGTCTTCAAAGCTATAGG - Intronic
996391053 5:122962595-122962617 AGCCAAGCCTACCAAGCTATGGG + Intronic
996647243 5:125830961-125830983 AGAAAAGAAATCAAAGCTATGGG + Intergenic
999915864 5:156259256-156259278 ACACAAATCATCAAAGATATAGG - Intronic
1003820722 6:9893716-9893738 AGCCAAGTGTTAAAAGCTTTTGG + Intronic
1003988952 6:11466770-11466792 AGCCAGGTCTTAAAAGTTATAGG - Intergenic
1005115250 6:22328943-22328965 ATAGAAGAGTTCAAAGCTATTGG + Intergenic
1005799806 6:29409678-29409700 AGCCTAGAGTTCAAAGCTATTGG - Intronic
1008019560 6:46560713-46560735 AGACAATTATTTAAAGCCATGGG + Intronic
1008741251 6:54611278-54611300 TGACCAGTCTTAAAAGCTACTGG - Intergenic
1008770334 6:54971045-54971067 AAACAAGTCTTTAAAGATGTAGG - Intergenic
1013627104 6:111949424-111949446 AGACAGGGACTCAAAGCTATTGG + Intergenic
1014470233 6:121804259-121804281 ACACATGTGCTCAAAGCTATAGG - Intergenic
1015420514 6:133002574-133002596 AGACAAGTCTTCTATGCCAGTGG + Intergenic
1015906654 6:138123833-138123855 AGACAAGACTGGAAAGATATAGG + Intergenic
1020701451 7:11489012-11489034 TGACATGTCTGCAATGCTATGGG - Intronic
1021084076 7:16400915-16400937 AGACAAGGCATAAAAGCTTTAGG - Intronic
1021469866 7:20989644-20989666 AGACAAGTCTTCCAAACAAAGGG + Intergenic
1021788653 7:24178097-24178119 AGATATGACTTTAAAGCTATGGG - Intergenic
1022873331 7:34502510-34502532 AGAAAAGTGTTCCAAGCTAGAGG + Intergenic
1023046546 7:36215135-36215157 ACCCGTGTCTTCAAAGCTATGGG - Intronic
1027989790 7:85343364-85343386 AGAGATGTCTTCAAAGATTTAGG + Intergenic
1028338764 7:89692063-89692085 AGTCTAGTCTTAAATGCTATAGG - Intergenic
1031800013 7:126231075-126231097 ATTCAATTCTTCTAAGCTATGGG - Intergenic
1032369906 7:131338340-131338362 AGAGAAGTCAGCAAAGCTTTTGG - Intronic
1033530606 7:142259265-142259287 ACACAAGTTTTCAAATCTTTTGG - Intergenic
1033765044 7:144479882-144479904 GGAAAAGTTTACAAAGCTATTGG - Intronic
1040575552 8:48648227-48648249 AGGAAAGTCTGCAAAGCCATTGG + Intergenic
1040717497 8:50274974-50274996 TGAGAAGTCTTCAAAAATATTGG - Intronic
1040810185 8:51443788-51443810 AGACATGTTTTCAAAAGTATAGG + Intronic
1041291640 8:56313810-56313832 ATACAAGCTTTCAAAGTTATTGG + Intronic
1042679063 8:71360253-71360275 AAACAATCCTTTAAAGCTATTGG - Intronic
1043706476 8:83357363-83357385 AGACTAGTCTTTGAGGCTATAGG - Intergenic
1043935168 8:86134052-86134074 AAACAAATCTTGAAAGCTATGGG + Intronic
1044335310 8:90976834-90976856 AAGCAAATCTTCAAAGCTTTTGG + Intronic
1045871561 8:106933649-106933671 AGACAAGTGCCCAAAGTTATAGG + Intergenic
1046667863 8:117024636-117024658 AGTGAAGTGTTCAAAACTATTGG - Intronic
1051687449 9:19673094-19673116 AGACAGGTCTTCAAGGCAAAAGG - Intronic
1052196643 9:25724672-25724694 ACACAAGTCTTCAAAGATAATGG - Intergenic
1055247953 9:74269647-74269669 ACAAAAGTCTCCAAAGATATAGG - Intergenic
1059207795 9:112483064-112483086 GGAAAAGTTTACAAAGCTATGGG - Intronic
1059850367 9:118331484-118331506 AGTGAGTTCTTCAAAGCTATAGG - Intergenic
1061916335 9:133756582-133756604 AAACAAGTCTTCAACGCGGTGGG - Intergenic
1190050778 X:47146938-47146960 AGACAAGACTTCACAACAATGGG - Intronic
1192058915 X:67802948-67802970 AGACAAGTCTTCAGGCCTACAGG + Intergenic
1192734638 X:73838203-73838225 CCACTAGTTTTCAAAGCTATGGG + Intergenic
1199485412 X:148341845-148341867 AGACAAATTTTGGAAGCTATAGG + Intergenic
1199705504 X:150421609-150421631 AGACATGTATGCAAACCTATAGG + Intronic
1200142047 X:153907286-153907308 AGCCAAGTCTTCAAAGCTGCAGG + Intronic
1201636854 Y:16132936-16132958 AGAAAAGGCTTAAAAGCTAAGGG + Intergenic
1202093504 Y:21218840-21218862 AGAGAACTTTTCAAACCTATAGG + Intergenic