ID: 996376111

View in Genome Browser
Species Human (GRCh38)
Location 5:122809416-122809438
Sequence CCTTGAAGCAGACTAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996376106_996376111 1 Left 996376106 5:122809392-122809414 CCTATAGCTTTGAAGACTTGTCT 0: 1
1: 0
2: 1
3: 7
4: 149
Right 996376111 5:122809416-122809438 CCTTGAAGCAGACTAAAAGGGGG No data
996376105_996376111 29 Left 996376105 5:122809364-122809386 CCTTTAGAGTACTTGACTCTACA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 996376111 5:122809416-122809438 CCTTGAAGCAGACTAAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996376111 Original CRISPR CCTTGAAGCAGACTAAAAGG GGG Intronic
No off target data available for this crispr