ID: 996377136

View in Genome Browser
Species Human (GRCh38)
Location 5:122822948-122822970
Sequence CTTCAGAACTCCATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996377130_996377136 27 Left 996377130 5:122822898-122822920 CCCCAAGGGGTTTAAACGCTTTA 0: 1
1: 0
2: 0
3: 5
4: 59
Right 996377136 5:122822948-122822970 CTTCAGAACTCCATGAAGCTGGG No data
996377131_996377136 26 Left 996377131 5:122822899-122822921 CCCAAGGGGTTTAAACGCTTTAT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 996377136 5:122822948-122822970 CTTCAGAACTCCATGAAGCTGGG No data
996377132_996377136 25 Left 996377132 5:122822900-122822922 CCAAGGGGTTTAAACGCTTTATT 0: 1
1: 0
2: 1
3: 256
4: 164
Right 996377136 5:122822948-122822970 CTTCAGAACTCCATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996377136 Original CRISPR CTTCAGAACTCCATGAAGCT GGG Intronic
No off target data available for this crispr