ID: 996377460

View in Genome Browser
Species Human (GRCh38)
Location 5:122827924-122827946
Sequence TTCTAGTTTGTTTTCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 642}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996377457_996377460 -8 Left 996377457 5:122827909-122827931 CCCCTTTCACTGTCTTTCTAGTT 0: 1
1: 0
2: 1
3: 37
4: 543
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377458_996377460 -9 Left 996377458 5:122827910-122827932 CCCTTTCACTGTCTTTCTAGTTT 0: 1
1: 1
2: 8
3: 79
4: 876
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377452_996377460 29 Left 996377452 5:122827872-122827894 CCAGTTTTAGGCCATCAGAAACC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377451_996377460 30 Left 996377451 5:122827871-122827893 CCCAGTTTTAGGCCATCAGAAAC 0: 1
1: 0
2: 0
3: 13
4: 142
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377456_996377460 8 Left 996377456 5:122827893-122827915 CCTCATGGGCAACTTTCCCCTTT 0: 1
1: 0
2: 2
3: 18
4: 168
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377459_996377460 -10 Left 996377459 5:122827911-122827933 CCTTTCACTGTCTTTCTAGTTTG 0: 1
1: 0
2: 3
3: 31
4: 408
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642
996377455_996377460 18 Left 996377455 5:122827883-122827905 CCATCAGAAACCTCATGGGCAAC 0: 1
1: 0
2: 2
3: 14
4: 155
Right 996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG 0: 1
1: 0
2: 4
3: 50
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996377460 Original CRISPR TTCTAGTTTGTTTTCCTTGT TGG Intronic
901368162 1:8772381-8772403 ATCTAATTTTTTTTCCTTGCTGG - Intronic
902307944 1:15557388-15557410 TTCTCTTTTGTTTTCATGGTTGG + Intronic
907738318 1:57138405-57138427 TTATATTGTGTTTTCCTTCTAGG + Intronic
908077529 1:60536840-60536862 TTCTAGTTTCTATTGCTTGCAGG + Intergenic
908219221 1:61986817-61986839 TTTTATTTTGTTTTGTTTGTTGG + Intronic
908594038 1:65666992-65667014 TTTTTGTGTGTGTTCCTTGTAGG + Intergenic
909843047 1:80354356-80354378 TTTTTGTTTGTTTTCTTTTTTGG - Intergenic
910165788 1:84326046-84326068 TTCTAGTGTGTTTTCATTGAAGG - Intronic
910372641 1:86533293-86533315 TTCTCTTTTGTTTTGCATGTGGG + Intergenic
910493391 1:87798245-87798267 GTGTATTTTGTTTTCCTTGAAGG - Intergenic
911155430 1:94631753-94631775 TTCTAGTATATTCTCCTAGTGGG + Intergenic
911637717 1:100253821-100253843 TTCTATTTTTTTTTTCTTTTAGG - Intergenic
911657394 1:100460647-100460669 ATCAAGTCTGTTTTCCTAGTTGG - Intronic
911868942 1:103066500-103066522 TTCCATTTTGTTTTACTTATTGG - Intronic
911881026 1:103238078-103238100 TTTTTGTTGTTTTTCCTTGTGGG + Intergenic
911968006 1:104392032-104392054 TATTAGTTTTTTTTGCTTGTTGG + Intergenic
912140461 1:106719532-106719554 ATCTGGTTTGTTTTGCTTGGGGG + Intergenic
912272572 1:108226133-108226155 TTCTAGTTTAGTTTCCTAGAGGG + Intronic
912295647 1:108468189-108468211 TTCTAGTTTAGTTTCCTAGGGGG - Intronic
912399746 1:109380112-109380134 TTTTTGTTTGTTTTCTTTTTTGG - Intronic
912540562 1:110411677-110411699 TTCTACTTTCTTTAGCTTGTGGG + Intergenic
912764639 1:112396968-112396990 TTCTACTTTCTGTTCCTTCTGGG + Intronic
912892641 1:113550952-113550974 TTCTTTTTTTTTTTTCTTGTTGG - Intronic
913444305 1:118933459-118933481 TTATAGTTTTTTTTTTTTGTGGG - Intronic
915210181 1:154302842-154302864 TTATAGTTAGTTTGCCCTGTTGG + Intergenic
916355807 1:163906227-163906249 TTCTAGTTTTATTCCCTTGTGGG + Intergenic
916398061 1:164413190-164413212 TTTAAGGTTGTTTTCTTTGTCGG + Intergenic
916772888 1:167930449-167930471 ATCTAGTTTTTTATCCTTGTTGG - Intronic
917153890 1:171974587-171974609 CTTTAGTTTGTTTTCTTTATAGG + Intronic
917370992 1:174294230-174294252 ATCTAGTCTGTATTCCTTTTGGG + Intronic
918025639 1:180742137-180742159 TTTTGGTTTGTTTTCAATGTTGG + Intronic
918270019 1:182889340-182889362 GTCTCATTTGTTTTCCTTATTGG + Intergenic
918287961 1:183077125-183077147 TTTGAGATTGTTTTCCTTTTAGG - Intronic
918391615 1:184069724-184069746 TTCTTGTTTGTTTCCATTATAGG - Intronic
918501370 1:185200271-185200293 GTCTAGTTTTTTTCTCTTGTTGG + Intronic
918775101 1:188618255-188618277 TTCTACTTTGTTGACTTTGTTGG - Intergenic
918786050 1:188765317-188765339 TTCCTGTTTGTTTTCCATGGGGG - Intergenic
919068452 1:192723664-192723686 CTCTATTTTTTTTTTCTTGTGGG - Intergenic
919347381 1:196401731-196401753 TTCTCATTTGTTTTCTTTTTGGG - Intronic
920187553 1:204170417-204170439 TTCTAGGTTTTTGTCCTGGTGGG + Intergenic
920206441 1:204295762-204295784 TGTTGGTTTGTTTTCCTTCTCGG - Intronic
921191922 1:212717386-212717408 TTCTCTCTTTTTTTCCTTGTTGG + Intergenic
921242853 1:213204442-213204464 ATAAAGTTTGTTTTCCATGTTGG + Intronic
921296716 1:213711534-213711556 ATCCAGTTTTTTTTCCTTGCTGG + Intergenic
921736820 1:218637934-218637956 TTTTTGTTTGTTTTGTTTGTTGG + Intergenic
921816357 1:219568529-219568551 AACTCTTTTGTTTTCCTTGTAGG - Intergenic
923234424 1:232018922-232018944 TTCTTGTTGGTTTTCCTTCCTGG + Intronic
924452377 1:244189998-244190020 TCCTCTTTTGTTTTGCTTGTAGG + Intergenic
1063050590 10:2442800-2442822 TTCCTCTTCGTTTTCCTTGTTGG - Intergenic
1064344629 10:14520912-14520934 TTCTCACTTGTTTTGCTTGTTGG + Exonic
1064556797 10:16554790-16554812 TTCTTGTTGGATTTCCTTTTGGG + Intergenic
1064721306 10:18232109-18232131 TTCTGATTTGTTTTTCTTTTGGG + Intronic
1065140040 10:22711799-22711821 TTCTGGTTTGATTTCATTTTAGG - Intronic
1065635863 10:27733141-27733163 TTGGAGTTTGTTTTTATTGTTGG + Intronic
1066079256 10:31913375-31913397 TTCTATTTTGTTTTCCCTTTAGG - Intronic
1066248621 10:33610908-33610930 TTTTTGTTTGTTTTTTTTGTTGG + Intergenic
1066377026 10:34866923-34866945 TTGTTTTTTGTTTTCCTTCTAGG - Intergenic
1066630069 10:37450500-37450522 TTCTAGTTTGCTTGCATGGTGGG - Intergenic
1066790682 10:39059512-39059534 TTCTGTTTAGTTTTTCTTGTGGG - Intergenic
1067216157 10:44305777-44305799 TTCTAACTTTTTTTTCTTGTGGG - Intergenic
1067366231 10:45631333-45631355 TTTTTGTTTGTTTTCTTTTTTGG - Intronic
1068288488 10:54970813-54970835 TTTAAAGTTGTTTTCCTTGTGGG + Intronic
1068481174 10:57590475-57590497 TTCTATTTTTTTTTCTTGGTGGG + Intergenic
1068949688 10:62764687-62764709 TTGTGGTTTGTTTACTTTGTTGG + Intergenic
1069139807 10:64809468-64809490 GTCCAGTTTTTTTCCCTTGTAGG + Intergenic
1069206633 10:65697225-65697247 TTCTATTTTATTTTGTTTGTTGG - Intergenic
1069357987 10:67609739-67609761 TTCTAGTTTGTTCCCCATGTAGG + Intronic
1070090288 10:73278169-73278191 TTCTAGTTACCTTTCTTTGTTGG + Exonic
1070100323 10:73379715-73379737 TTGTTGTTTGTTTTCTTTATTGG - Intronic
1070210484 10:74314645-74314667 TTCTACTGTGATTTCCTTATAGG + Exonic
1070492130 10:76987331-76987353 TTCTAATTTGGTTTCCGGGTGGG + Intronic
1070967326 10:80537565-80537587 TTCCATTTTGTTTTCTTTCTTGG + Intergenic
1071100446 10:82030642-82030664 TTCCATTTCGTTTTCCTTTTTGG + Intronic
1072274086 10:93805450-93805472 TTCTGTTTTTTTTTGCTTGTAGG + Intergenic
1072301008 10:94062277-94062299 TTCTTGTTTTTTTTCATTTTTGG + Intronic
1073763843 10:106660130-106660152 TTCTGTTTTGGTTGCCTTGTGGG - Intronic
1073795238 10:106980155-106980177 TTTTTGTTTGTTTTCCTTCTTGG - Intronic
1074092091 10:110270374-110270396 TTGGAGTTTGGGTTCCTTGTGGG + Intronic
1074149288 10:110743926-110743948 TTTTATTTGGTGTTCCTTGTTGG + Intronic
1074283202 10:112072805-112072827 TTCTAGTTTTTTTTTTTTGGAGG - Intergenic
1074737360 10:116449681-116449703 TTCTTATTTGTTTTCCATCTAGG - Intronic
1075074295 10:119340573-119340595 TTGTAGTTTGTTCTGCTTCTAGG + Intronic
1077911235 11:6572629-6572651 GTCTATTTTGTTTTCTTTATAGG - Intronic
1077988477 11:7379531-7379553 TTCTTGTGTCTTCTCCTTGTTGG + Intronic
1078379077 11:10823406-10823428 TTCTGTTTTGAGTTCCTTGTTGG - Intronic
1078873448 11:15370894-15370916 TGCTAGTTTGTTTTGCCTCTTGG + Intergenic
1079666227 11:23109439-23109461 TTCTAGATTGTTTTTATTTTTGG - Intergenic
1079962625 11:26942874-26942896 TTCTATTTAGACTTCCTTGTTGG - Intergenic
1080152677 11:29072368-29072390 TGCTTGGTAGTTTTCCTTGTAGG + Intergenic
1080161029 11:29176440-29176462 TTCTATTATATTTTCATTGTTGG - Intergenic
1080236277 11:30071875-30071897 TTCTAGTTTTGTTCCCTGGTAGG - Intergenic
1080335239 11:31187994-31188016 TTTTAATTTTTTTTCCTTTTTGG + Intronic
1080843847 11:36008808-36008830 TACTGCCTTGTTTTCCTTGTAGG + Intronic
1080959071 11:37136653-37136675 TTCTAGTTTGTTTACATAGAAGG - Intergenic
1080970039 11:37262939-37262961 TGCTTGTTTGTTTTGCATGTTGG - Intergenic
1081175996 11:39927145-39927167 TTCAAGTTTGTTCTCCTGATGGG - Intergenic
1081352809 11:42075077-42075099 TTCTATTTTGTGTCCCTTGTGGG + Intergenic
1081953345 11:47066071-47066093 TTCTAATTTGGATGCCTTGTGGG + Intronic
1082728223 11:56763245-56763267 TTCTACTTTGTTCTCTTTGTTGG - Intergenic
1083206849 11:61156091-61156113 TTCCACTTTGTTTCCTTTGTTGG - Intronic
1083702523 11:64489144-64489166 TTCGGGTTTCTTTGCCTTGTGGG + Intergenic
1083908853 11:65693328-65693350 TTCTTGTTTGTCTTCCATGAGGG + Intergenic
1084777327 11:71386184-71386206 TTTTAATTTGTTTTCCATGCTGG + Intergenic
1085303418 11:75471912-75471934 TCCTAGTTTCTTATCCTTATAGG + Intronic
1086114424 11:83232367-83232389 TACTATTTTGATTTCCTTTTTGG + Intronic
1086219808 11:84428890-84428912 TTTTAGTTTGATGTCATTGTTGG + Intronic
1086603834 11:88669886-88669908 TTCCAGTGGGTTTTCCTTGGTGG + Intronic
1086813648 11:91341715-91341737 TTTTTGTTTTTTTTTCTTGTTGG - Intergenic
1087859356 11:103134789-103134811 TTCCAGATTTTTTTCCTTTTTGG + Intronic
1088219413 11:107552040-107552062 TTTAATTTTGTTTTGCTTGTGGG - Intronic
1088614113 11:111605750-111605772 TTCAAGTCTGTTTCCCTTTTAGG + Intronic
1088978341 11:114835965-114835987 TTCTTGTTTGTTTTATTAGTGGG - Intergenic
1089092778 11:115892146-115892168 TTCTAGTTTTTCTTACTAGTTGG + Intergenic
1090772078 11:129929899-129929921 TCATAGCTTGTTTTCCTTGCTGG + Intronic
1090875100 11:130781851-130781873 TTTTATTATGTTTTCATTGTAGG + Intergenic
1091098298 11:132844806-132844828 TTGTAGCTTGTATTCCTTCTGGG + Intronic
1091135256 11:133182698-133182720 TTTCACTTTGTTTTCCTTGCAGG - Intronic
1092197705 12:6559797-6559819 TTGTGGTTTCTTTTCCTTCTTGG - Intronic
1092394384 12:8112632-8112654 CTTTAGTGTGTTTTCCTTATGGG + Intergenic
1092523529 12:9295697-9295719 CACCATTTTGTTTTCCTTGTAGG - Intergenic
1092543767 12:9436202-9436224 CACCATTTTGTTTTCCTTGTAGG + Intergenic
1093510740 12:19924605-19924627 TTCTGGTTTGCTTTCCCAGTTGG - Intergenic
1094210036 12:27879472-27879494 TTCTGTTTTGTTTTCCATATTGG + Intergenic
1094509178 12:31085849-31085871 CACCATTTTGTTTTCCTTGTAGG - Intronic
1094757986 12:33493690-33493712 GTCTAGTTTTGTTTCCTTGCTGG - Intergenic
1095282016 12:40363380-40363402 TTCTATTTTTTTTTCTCTGTAGG + Exonic
1095716667 12:45353677-45353699 TTCCAGTTTGGTTTGCTTTTTGG - Intronic
1095753376 12:45735107-45735129 TTCTATTTTTTTTTTCTTGGTGG + Intronic
1096019127 12:48307551-48307573 TTTTGTTTTGTTTTCCTTCTTGG + Intergenic
1096220484 12:49825875-49825897 TTCTTGTTTGTTTTCATCCTCGG - Intronic
1096753290 12:53777140-53777162 TTCTCATTTCCTTTCCTTGTGGG + Intergenic
1097596556 12:61640118-61640140 TTCCAGTTTGTGGTTCTTGTAGG + Intergenic
1098082659 12:66806020-66806042 TTCTAGTTTGTTTTGGTTGAGGG - Intergenic
1099554908 12:84098546-84098568 GTCTAGTTTTGTTTCCTTGCTGG - Intergenic
1099571936 12:84333085-84333107 TTCTAGTTCGTCTTCACTGTAGG - Intergenic
1099883169 12:88494025-88494047 TGCTATTTTGTCTTCTTTGTCGG + Intronic
1100258354 12:92906882-92906904 TTCTAATTTGTTTTTATGGTGGG - Intronic
1100295776 12:93259638-93259660 ATTTAGTTTGTTTGCCTTTTTGG + Intergenic
1100465624 12:94842244-94842266 TTCTCCTTTCTCTTCCTTGTTGG - Intergenic
1100812385 12:98352058-98352080 TTTTTTTTTTTTTTCCTTGTGGG - Intergenic
1100897893 12:99205065-99205087 TTTTGGTTTGTTTTTCTTTTTGG - Intronic
1101437933 12:104679913-104679935 CTCTGGTTTGTTTTTGTTGTTGG + Intronic
1101467393 12:104961893-104961915 CTCTAGTTCTTTTTCTTTGTGGG - Intergenic
1102860192 12:116329757-116329779 TTCTAGTTTGTTTGTTTGGTTGG + Intergenic
1103685098 12:122726005-122726027 TTTTAGCTTTTTTTCCTTGGAGG + Intergenic
1103886156 12:124202154-124202176 TTTTAAGTTGTTTTCCTTTTTGG - Intronic
1104105917 12:125659220-125659242 TTCTTATTTGTTATCCTAGTAGG + Exonic
1104361096 12:128133724-128133746 TTCTAGCTTGTTTGCATTATTGG - Intergenic
1104737303 12:131143678-131143700 TTCTTTTTTGTTTTGCTTTTTGG + Intergenic
1105008015 12:132735159-132735181 TTCTAATTGGAATTCCTTGTTGG - Intronic
1105060787 12:133148729-133148751 TTCTAGGTTGTATTCAATGTTGG + Intronic
1105901698 13:24760293-24760315 TTCAAGTTTATTTTCCCCGTTGG - Intergenic
1105999561 13:25708189-25708211 TTCTGGTTTGTTTTTCTAGTAGG - Intronic
1106027863 13:25972471-25972493 TTTTAGTTTGTTCTTCTTGAAGG + Intronic
1106065118 13:26340308-26340330 TACTAATTTATTTTCATTGTGGG + Intronic
1106827271 13:33537707-33537729 TTTTCTTTTCTTTTCCTTGTTGG - Intergenic
1106988549 13:35386704-35386726 TTCAGGTTTGTTTGCCTTGATGG - Intronic
1107181851 13:37470845-37470867 TACTATTTTGTTTTCTTTCTAGG - Intergenic
1107680730 13:42847411-42847433 TTCTGATTTTTTTTCCTGGTGGG - Intergenic
1108169508 13:47726676-47726698 TTCTGTGTTGTTTTTCTTGTTGG + Intergenic
1108179983 13:47831033-47831055 TTCAAGTTTATTTTCTTTCTAGG - Intergenic
1108483605 13:50901670-50901692 TACTATTTTATTTTCCATGTTGG - Intergenic
1108766471 13:53636770-53636792 TTCTTATTAGTTTTCCTTGGGGG + Intergenic
1108823506 13:54382521-54382543 TTTTAGTTTTTTTTTGTTGTTGG + Intergenic
1108926330 13:55751037-55751059 GTCTAGTTTTTTTTTGTTGTTGG + Intergenic
1109106560 13:58259281-58259303 TTTTTGTTTTTTTTCCTTTTGGG + Intergenic
1110156408 13:72322274-72322296 TTCTAATTTATTTTCCTAGAGGG - Intergenic
1110719631 13:78746715-78746737 ATCTGTTTTGTTTTCCATGTTGG - Intergenic
1111042266 13:82764556-82764578 TTCTTGTTTCTCTTGCTTGTTGG + Intergenic
1111059406 13:82994106-82994128 TTCTTGTTTAATTTCCTTCTTGG - Intergenic
1111204515 13:84987760-84987782 TTTCAGTTAGTTTTCCATGTGGG - Intergenic
1111398173 13:87695688-87695710 TTCTACTTGTTTTGCCTTGTTGG + Exonic
1113142416 13:107169107-107169129 TTGTATTTTATTTTCTTTGTGGG - Exonic
1114242263 14:20879282-20879304 TTTTAGTTTGTTTTTTTTGAAGG - Intergenic
1114895039 14:26978105-26978127 TTCTAGTTTCTCTTCCTTTTTGG + Intergenic
1114969094 14:28003013-28003035 TTTTGTTTTGTTTTCCCTGTGGG + Intergenic
1115306025 14:31934487-31934509 TTTTAGGTTGTTTTCCTTCTGGG + Intergenic
1115514977 14:34176041-34176063 TACTAGTTGGTTCACCTTGTAGG - Intronic
1115874281 14:37843415-37843437 ATTTGGTTTGTTTTCCTTCTTGG + Intronic
1115947431 14:38677825-38677847 TTCTATTTTTCTTTCCTTATAGG + Intergenic
1116114838 14:40634980-40635002 TTCGATTTTGTGTTCCTTTTGGG - Intergenic
1116114853 14:40635177-40635199 TTCAATTTTGTTTTCCTGTTGGG - Intergenic
1116126590 14:40796492-40796514 TTCTTATTTTTTTCCCTTGTAGG + Intergenic
1116321422 14:43469767-43469789 TTCTATTTTATCTCCCTTGTGGG + Intergenic
1116495997 14:45561049-45561071 TCCTAGTTTATTTTCCTACTTGG - Intergenic
1116689557 14:48087801-48087823 TTCTAGTTTCTTTTCCATGTTGG + Intergenic
1116808277 14:49514375-49514397 TTTAAGCTTGTTTACCTTGTAGG - Intergenic
1117151563 14:52893358-52893380 TTCTTCTTTTTTTTCTTTGTTGG + Exonic
1118426923 14:65675632-65675654 TTCTAGGTTATTTACCTTCTAGG + Intronic
1118744878 14:68766607-68766629 TTCTATTTTCTTTGCCTTCTTGG + Intergenic
1118814120 14:69297630-69297652 TTGTAGTTTGTTTTTTTTTTTGG - Intronic
1119218607 14:72888444-72888466 TTGTAATTTGTTTTTCTTATTGG - Intronic
1119276135 14:73357905-73357927 TTTTAGTTTGTTTTTTTTGGTGG - Intronic
1119958108 14:78822693-78822715 TTTTTGTTTGTTTTTGTTGTTGG - Intronic
1120203166 14:81560458-81560480 TTAGTGTTTGTTTTTCTTGTTGG + Intergenic
1121493107 14:94373974-94373996 TTCTAATGGGGTTTCCTTGTGGG + Intergenic
1122357707 14:101133493-101133515 TTCTTGTTTGTTTTTAATGTTGG + Intergenic
1122435883 14:101697635-101697657 TTCTAGTTTTGTTCCATTGTGGG - Intergenic
1122845226 14:104491440-104491462 TTCTAATTTAATTTCATTGTGGG - Intronic
1123142728 14:106096620-106096642 TTTTGTTTTGTTTTCCTTGCTGG - Intergenic
1123218379 14:106833134-106833156 TTTTGCTTTGTTTTCCTTGCTGG - Intergenic
1123753189 15:23374111-23374133 TTTTTGTTTGTTTTTGTTGTTGG - Intergenic
1124063644 15:26319535-26319557 CTCTGGTTTGTTTTCCAGGTGGG - Intergenic
1124723112 15:32130032-32130054 GTCTAGTTTGATTCCATTGTGGG + Intronic
1126952801 15:53900661-53900683 TTCTATTTTTTTTTCACTGTGGG + Intergenic
1127117181 15:55740684-55740706 TTCTCCTTTTTTTTCCTTATAGG - Exonic
1127303149 15:57677265-57677287 TTTTAGTTTGTTTTGTCTGTTGG + Intronic
1127489260 15:59446840-59446862 TTTTACTTTCATTTCCTTGTGGG - Intronic
1127712822 15:61618209-61618231 TTCTTGTTTGCTTTGCTTTTGGG - Intergenic
1127862380 15:63005138-63005160 TTCTACTTTGAGTTCCTTGTTGG + Intergenic
1127941382 15:63700425-63700447 TGTTAGTTTGTTTTCTCTGTGGG - Intronic
1128568395 15:68716005-68716027 GTCTAGCTTGCTTTCCCTGTGGG + Intronic
1128613534 15:69092036-69092058 TTCTAATTTGAATTCCCTGTTGG - Intergenic
1128990122 15:72252826-72252848 TTGTTGTTTGTTTTCTTTTTTGG - Intronic
1129645315 15:77424708-77424730 ATTTAATTTTTTTTCCTTGTGGG + Intronic
1129702847 15:77777757-77777779 GGCTAGTTTGTTTTACTTTTTGG - Intronic
1130558523 15:84940871-84940893 TTCTTTTTTGTTTTCCCTTTAGG + Intronic
1131086564 15:89580364-89580386 TTTTTGTTTGTTTTCCTGGCTGG + Intronic
1131451656 15:92545687-92545709 TTCTAGCTTGTTTACTTTCTAGG - Intergenic
1133241969 16:4419942-4419964 TTGTTGTTTTTTTTCTTTGTGGG + Intronic
1134036484 16:11035227-11035249 TTCTAGCATGTTTTCTGTGTGGG + Intronic
1134332288 16:13262176-13262198 TTTTATTTTGTTTTCTTTGGAGG - Intergenic
1134560758 16:15207481-15207503 TTCTGGCTTGTTTTCCTTCTGGG - Intergenic
1134921296 16:18119101-18119123 TTCTGGCTTGTTTTCCTTCTGGG - Intergenic
1136015061 16:27391896-27391918 TTTTATTTTGTTTTTCTTTTTGG + Intergenic
1136521125 16:30796544-30796566 TGTTTGTTTGTTTTCTTTGTAGG + Intergenic
1136729688 16:32398165-32398187 TTCTCTTTTTTTTTCCTTATTGG + Intergenic
1137891201 16:52164075-52164097 TTCTAGTTTGTTTTATATGAAGG - Intergenic
1138264307 16:55649278-55649300 TTCCAGTTTTTTTTTCTTTTTGG - Intergenic
1138331439 16:56218930-56218952 TTCTATTATCTTTTCATTGTGGG + Intronic
1138397923 16:56720634-56720656 TTCTGGGTTGTTTCCCCTGTTGG + Intronic
1139119664 16:63999991-64000013 TTGTTGTTTGTTTTGTTTGTTGG - Intergenic
1139339776 16:66260795-66260817 TTATAGTCTGTTTTTCTTCTAGG - Intergenic
1140909748 16:79440435-79440457 TTCTTCTTTTTTTTCCTTTTGGG + Intergenic
1142907733 17:3056632-3056654 TTCTAGTTGGATTTCTGTGTGGG + Intergenic
1142926832 17:3247627-3247649 TTCTAGTTGGATTTCTGTGTGGG - Intergenic
1143363701 17:6391708-6391730 TTCTAGTTGAGTTTCCTTGAGGG - Intergenic
1143536669 17:7544772-7544794 TTCTTTTTTGTTTTTCTTTTTGG - Intergenic
1144380768 17:14695751-14695773 TTCTAGTGCTTTTTGCTTGTGGG - Intergenic
1145232381 17:21183146-21183168 TTCTAGTTTTTCTAACTTGTTGG + Intronic
1146696842 17:34915588-34915610 TTCTAATGTGCTTTCCTGGTTGG - Intergenic
1148148892 17:45384488-45384510 TCCTTGGTGGTTTTCCTTGTGGG - Intergenic
1148555278 17:48575322-48575344 GGCTGGTTTGTTTTCCTTTTAGG - Intronic
1148883685 17:50755279-50755301 TTCCAAGTTGTTTTCTTTGTGGG + Exonic
1148938459 17:51185077-51185099 TTCTTGTTTGTTTCCGTTGTTGG - Intronic
1149235602 17:54587062-54587084 TTATTGATTGTTTCCCTTGTTGG - Intergenic
1150044055 17:61893735-61893757 TTTTATTTTGTTTTATTTGTAGG + Intronic
1150720883 17:67613248-67613270 TTTAAGTTTGTTTTCCTTTGTGG - Intronic
1150870247 17:68900873-68900895 TTCTAGTTTTTTTTTGTTTTAGG - Intronic
1150925564 17:69528390-69528412 TTCCTGTCTGTTTTCCTTGAGGG + Intronic
1151071957 17:71224918-71224940 TTATGGTTTATTTACCTTGTGGG - Intergenic
1151929069 17:77219535-77219557 TTCTGGCTTGCTTTCATTGTTGG - Intergenic
1153065992 18:1045744-1045766 TTGTAGCTTGTTTTCCTTTTGGG + Intergenic
1153390164 18:4548251-4548273 TTCTCATTTTTTTTCCTTCTTGG - Intergenic
1153595624 18:6722419-6722441 TTTTTGTTTGTTTTGTTTGTTGG + Intergenic
1155597613 18:27505990-27506012 TTCTAGTTTTACTTCATTGTGGG - Intergenic
1155656364 18:28197065-28197087 GTTTTGTTTGTTTTCTTTGTGGG + Intergenic
1155880481 18:31142055-31142077 TTCCATTTTCATTTCCTTGTAGG + Exonic
1156579220 18:38355935-38355957 TTCTAGTTAGTGTTCCTAATGGG + Intergenic
1156600440 18:38599274-38599296 TTCTGCTTTGTTTTCCATATGGG - Intergenic
1156615459 18:38778214-38778236 TTTTAGTTGCTTTTCCTTCTTGG - Intergenic
1156919685 18:42505874-42505896 TTCTAGTCTGTTCTACTTTTTGG + Intergenic
1157049627 18:44147112-44147134 TTATATTTTATTTTCTTTGTTGG - Intergenic
1157734014 18:50030570-50030592 TTCTAGTTAGTGGTCCTGGTTGG - Intronic
1158246016 18:55432590-55432612 ATCTAGTTTGTTTACTTTTTGGG - Intronic
1158254585 18:55531451-55531473 TTCTATTTTGCTATCTTTGTTGG - Intronic
1158273185 18:55738583-55738605 TTATACTTTGTTTTCATTTTTGG - Intergenic
1158406519 18:57164793-57164815 TTCTATTTTTTTTTCCTTTTGGG + Intergenic
1159029437 18:63215855-63215877 TTTTACTTTATTTTCCTTATAGG + Intronic
1159498973 18:69243529-69243551 TACTAGTTTTTTTTCCATCTAGG - Intergenic
1164383661 19:27755656-27755678 ATCAAGATTGTTTTCCTGGTGGG + Intergenic
1164856232 19:31526738-31526760 TTTTAGTTTAATTTCCTTCTTGG - Intergenic
1166028906 19:40110644-40110666 TTCTAATTGTTTTTCCTTATGGG + Intergenic
1166522471 19:43490003-43490025 TTCTTTTTTTTTTTCCTTTTTGG - Intronic
1168014908 19:53565145-53565167 TTCTATTTAGTTTCCCTTGCTGG - Intronic
1168614390 19:57826189-57826211 TTTTATTTTGTTTTCATTTTGGG - Intronic
925087429 2:1119120-1119142 TGTTTGTTTGTTTTCCCTGTAGG - Intronic
925248690 2:2410079-2410101 TTTTTGTTTGTTTTGCTTGGAGG + Intergenic
925554061 2:5109855-5109877 TTGTACTTTGTTTTTGTTGTTGG + Intergenic
925710577 2:6735484-6735506 TTCTAAATTGTTTACCCTGTTGG + Intergenic
925771643 2:7288167-7288189 TGCTAGTTTGAGTTCCTTGGAGG + Intergenic
926012552 2:9420443-9420465 TTCATGTGTGTTTTTCTTGTTGG - Intronic
926389431 2:12372977-12372999 TCCTATTTTGGTTTCCTAGTTGG + Intergenic
926557547 2:14377224-14377246 TTGTTTTTAGTTTTCCTTGTAGG - Intergenic
926954055 2:18274001-18274023 TTATTATTTGTTTTCTTTGTTGG + Intronic
927102939 2:19801747-19801769 TTCTAGTAAGTGTGCCTTGTGGG + Intergenic
927113407 2:19880028-19880050 TCCTAGTGTGTTTCCCTAGTGGG + Intergenic
927420204 2:22922936-22922958 GTCTTGTTTGTTGTCCTTTTGGG + Intergenic
927535001 2:23848669-23848691 TTCCAGTTTGTTTCCATTGCTGG - Intronic
928828196 2:35445780-35445802 GTTTAGTTAGCTTTCCTTGTGGG + Intergenic
929139911 2:38657794-38657816 TACTAGTTTGTTCTACTTATGGG + Intergenic
929631522 2:43467552-43467574 TTCTATTTTTATTTCCCTGTGGG + Intronic
930777220 2:55185204-55185226 TTCTTCTTGGTTTTCCTTATTGG - Intronic
930818794 2:55624846-55624868 TTGTATTTTGTTTGCCTTTTGGG + Intergenic
932018356 2:68056597-68056619 TTCTTGTTTATTTTTCTTTTGGG - Intronic
932115865 2:69046366-69046388 TTGTGGTTTGTTATGCTTGTTGG + Intronic
932452662 2:71824366-71824388 TTCTATTTTTTTTTCTTTGCTGG - Intergenic
932503944 2:72210731-72210753 TTGCACTTTGTTTTTCTTGTGGG + Intronic
932516108 2:72351237-72351259 TCTTAATTTGTTTTCTTTGTAGG - Intronic
932902397 2:75714483-75714505 TTCTTATTAGTTTTCCTTTTGGG - Intergenic
933233653 2:79839659-79839681 TTCTAGTTTTTTTTCTTAGCTGG + Intronic
933340249 2:81016362-81016384 TTATAGTATATTTTCTTTGTAGG - Intergenic
933360939 2:81283130-81283152 TTTTAGTTTGCTTTCCTTGTAGG - Intergenic
933443556 2:82347425-82347447 TTTTATTTTGTTTCCCTTCTTGG + Intergenic
933554599 2:83816252-83816274 TTCTAGTTTTATTACATTGTAGG + Intergenic
934106244 2:88697573-88697595 TTCTTGTTTGGTCTGCTTGTAGG + Intronic
934106247 2:88697611-88697633 TTCTTGTTTGGTCTGCTTGTAGG + Intronic
935454085 2:103245362-103245384 TTTTAGTTTATTTTTCTTGAAGG + Intergenic
936722674 2:115272480-115272502 TTCTATTTTCTTTTCCTTTTTGG - Intronic
936769408 2:115894118-115894140 CTCTAGTTTTGTTTCCTTGCAGG + Intergenic
937144867 2:119635988-119636010 TTTTAGTTTGGTTTCCTATTTGG - Intronic
937537766 2:122912330-122912352 TTTTTGTTTGTTTTCCATGCTGG + Intergenic
937672635 2:124554836-124554858 CTCTAGTTTGTGTCTCTTGTAGG - Intronic
938563589 2:132496520-132496542 TTCTGTTTTATTTGCCTTGTTGG - Intronic
938815812 2:134903034-134903056 TTCAACTTTGTTTTCCTTTTTGG - Intergenic
938926270 2:136045626-136045648 TTCTAATTTGTCTTGCTTTTAGG + Intergenic
939096198 2:137836387-137836409 TTTTTTTTTTTTTTCCTTGTGGG + Intergenic
939263242 2:139837100-139837122 TTCTATTCTGTTTTACTTTTTGG + Intergenic
940053744 2:149491730-149491752 ATCAAGTTTGTTTTCTTTCTAGG + Intergenic
940243200 2:151585738-151585760 TTCTGGGTTCTTTTCGTTGTTGG + Intronic
940244156 2:151596291-151596313 TTCTGGGTTCTTTTCGTTGTTGG + Intronic
940245114 2:151606837-151606859 TTCTGGGTTCTTTTCGTTGTTGG + Intronic
940705187 2:157096590-157096612 TTCCATTTTATCTTCCTTGTTGG + Intergenic
940937278 2:159510781-159510803 TTCTAGTTCCTTTTCCTTAAAGG + Intronic
941161346 2:162038422-162038444 TGCTTGTTTTTTTTCCTTCTAGG - Exonic
941973415 2:171377309-171377331 TTTTATTTTGTTTTGCTTTTGGG - Intronic
942013136 2:171784749-171784771 TCCTAGTTTGTTTTCCATTCTGG - Exonic
942019375 2:171851190-171851212 TTCTTGTTTGTTTTTTTTTTTGG + Intronic
942663870 2:178295695-178295717 TTTTGATTTGTTTTCCTTATTGG + Intronic
943236187 2:185322899-185322921 TTCTAGTTTTTTACCATTGTTGG - Intergenic
944411130 2:199443472-199443494 TTCTAGTATGATTTCCTTTGAGG - Intronic
944500108 2:200350341-200350363 TTCTCATTTGTTGTCCTTTTGGG + Intronic
944740022 2:202602987-202603009 TTCTACTGTGTATTCTTTGTTGG - Intergenic
945074825 2:206027724-206027746 TTTTAGTTTCTTTTCAGTGTTGG - Intronic
945230728 2:207586697-207586719 TTTTTGTTTGTTTTCCTGTTCGG - Intronic
945377131 2:209092082-209092104 TTCCATCTTGATTTCCTTGTTGG + Intergenic
945529147 2:210928154-210928176 TTTTACTTTACTTTCCTTGTTGG + Intergenic
946373203 2:219293125-219293147 TATTAATTTGTTTTCCTTCTAGG + Intronic
946515907 2:220411688-220411710 TTCTTTTTTGTTGTCCTTGGGGG + Intergenic
946596562 2:221311697-221311719 TTCTAGTTTGTGGTGTTTGTTGG - Intergenic
947342513 2:229154949-229154971 TTCTAGTTTTGTTTCCACGTTGG + Intronic
948225519 2:236306555-236306577 ATCTAATTTGGTTTCATTGTGGG - Intergenic
1168737717 20:157587-157609 TTCTGGTTTGGTTTACCTGTGGG - Exonic
1168901624 20:1369838-1369860 TTTTATTTTGTTTTCATTTTGGG - Exonic
1169166588 20:3429518-3429540 ATCTTGTTTGTTTTTCTTCTGGG + Intergenic
1169319717 20:4622317-4622339 TTCTAATTTGATTGCATTGTGGG + Intergenic
1169546133 20:6652884-6652906 TAATAGTGTCTTTTCCTTGTGGG + Intergenic
1169907511 20:10618399-10618421 TCCTATTTTGTTTTACTTTTTGG - Intronic
1170026527 20:11894514-11894536 TTTTCTTTTGTTTTCCTTTTTGG + Intronic
1170049519 20:12127048-12127070 TTCTAGTTTGATTGCACTGTGGG + Intergenic
1170080372 20:12468399-12468421 TTCTAGCTTGTTTTTCCTGTGGG - Intergenic
1170087457 20:12550489-12550511 TTCCATTTTGTTTTTCTTTTTGG + Intergenic
1170366660 20:15605544-15605566 TTCTATTTGGTTTTGCTTTTTGG - Intronic
1172665309 20:36595155-36595177 TTCAAGTCTGTTTTCCTTCAGGG + Intronic
1172927631 20:38553169-38553191 TTCAAGTTTGTTTTCATGGATGG + Intronic
1173049708 20:39547386-39547408 TTTTTGTTTGTTTTAATTGTTGG + Intergenic
1173628248 20:44489803-44489825 ATCTATTTTGTTTTGCTTTTTGG + Exonic
1174623556 20:51895648-51895670 TGCCAGTTTTCTTTCCTTGTGGG + Intergenic
1175221391 20:57418880-57418902 TTCACGTTTGTTTTCCTTTCAGG + Intergenic
1177196297 21:17906935-17906957 TTCTAGATTGTTTTTTTTTTTGG - Intronic
1177722467 21:24926385-24926407 TTTTGCTTTGTTTTCCTTTTTGG - Intergenic
1177946681 21:27479349-27479371 TTCAAGATTGTTTGCCCTGTTGG - Intergenic
1178147638 21:29758175-29758197 TCTTAGTTTGTTTTCCTCTTTGG - Intronic
1178174941 21:30085899-30085921 TTCTGCTTTGTATTCCTTGTAGG - Intergenic
1178509249 21:33189098-33189120 TTCAAGTTCCTTTTCCTGGTGGG - Intergenic
1179049978 21:37880839-37880861 TTCTCATCTGTTTTCCTTGGAGG - Intronic
1179772556 21:43633421-43633443 TTCAATTTTGTTTTGCTTTTAGG - Exonic
1181884716 22:26011163-26011185 TTCTATGTTGGTTTCCTTCTGGG + Intronic
1182175376 22:28280685-28280707 TTCTCCTTTTTTTCCCTTGTAGG + Intronic
1183246840 22:36700330-36700352 CTCTAGTCTGTTTGCCTTCTGGG + Intronic
1183248080 22:36709408-36709430 ACCTAGTTTGTTCTTCTTGTAGG + Intergenic
1183342168 22:37287464-37287486 TTCTGTTTTGTTTTGTTTGTTGG - Intronic
1185425312 22:50766463-50766485 GTCTAGGTTGTTTGCCTGGTGGG - Intergenic
949893846 3:8754386-8754408 TTCTTAGTTGTTTTCCTTGTGGG - Intronic
950156010 3:10722209-10722231 CTCTAGTGATTTTTCCTTGTGGG + Intergenic
950273888 3:11642308-11642330 TTGTTGTTTTTTTTCCTTGAAGG + Intronic
951587345 3:24229001-24229023 TTTTTGTATTTTTTCCTTGTAGG - Exonic
951647638 3:24910897-24910919 ATCTAGTTCCTTTTCCTTTTGGG - Intergenic
951725757 3:25756805-25756827 CACTAGTTTATTTTCTTTGTTGG - Intronic
952103505 3:30042646-30042668 TTTTTGTTTGTTTTCCATGTGGG - Intergenic
953118363 3:40015023-40015045 TTCTATTTGCTTTTCCTAGTGGG + Intronic
953266193 3:41391107-41391129 TTCATGTTTCTTTTCTTTGTTGG + Intronic
955051992 3:55421456-55421478 TTGTCATTTGTTTTCTTTGTGGG - Intergenic
956870953 3:73417299-73417321 TTCTATTCAGTTTTCCTTATGGG - Intronic
956945628 3:74219209-74219231 TTGTAGCATTTTTTCCTTGTAGG + Intergenic
957039511 3:75326685-75326707 ATGTAGTGTGTTTTCCTTGCTGG - Intergenic
957420212 3:79957986-79958008 TTCTAGTTTTTCTTTCTTGCTGG + Intergenic
958136217 3:89496639-89496661 TTCTAGTATGTTTTACTCATAGG + Intergenic
958184913 3:90108316-90108338 TTCTAGTTTGATTGCACTGTGGG + Intergenic
959259280 3:104053788-104053810 TTCTAGTTTTATTCCATTGTGGG - Intergenic
959323874 3:104911366-104911388 CTGTAGTTTGTTTTACTTATGGG + Intergenic
960041456 3:113153791-113153813 TTTTACTTTGTTTTCCGTTTTGG + Intergenic
960219548 3:115089070-115089092 TTTAAGTTTGTTTCCTTTGTAGG - Intronic
960442568 3:117707116-117707138 TTTTTGTTTTTTTTCCTTCTGGG + Intergenic
960481472 3:118196572-118196594 TGCTTGTTTTTTCTCCTTGTTGG + Intergenic
960519827 3:118641829-118641851 TTCTTGTTTCTTTGCCTTGGGGG - Intergenic
960818976 3:121706760-121706782 TTGCATTTTGTTTTCTTTGTTGG - Intronic
960873068 3:122269819-122269841 CTTTAGTTGGTTTTCTTTGTGGG + Intronic
961762329 3:129180789-129180811 TTCTGCTTTTTTTTCCTTGCAGG - Intronic
962017997 3:131463336-131463358 ATCTTGTTTGTTTTATTTGTTGG - Intronic
962558328 3:136578956-136578978 TTCTAGTTTATTATCTTGGTAGG - Intronic
963218313 3:142776429-142776451 TTCTGGTTTGTTTTCTATTTAGG + Intronic
963453840 3:145518448-145518470 TTTCAGTTTGTATTACTTGTGGG + Intergenic
963778421 3:149463476-149463498 TTTTATTTTGTTTTCATTTTGGG - Intergenic
963950875 3:151199304-151199326 TTTTATTTAGTTTTCCTTGTTGG - Exonic
964589536 3:158344895-158344917 TGCTATTTTATATTCCTTGTTGG - Intronic
965303060 3:167028276-167028298 TTCTATGTTCTTTTCTTTGTAGG - Intergenic
965526849 3:169729581-169729603 TTGTAGGTTGTTTTCCTTTAAGG + Intergenic
966014092 3:175119642-175119664 TTTTAGTTTGTTTAACTTGAAGG + Intronic
966449966 3:180047803-180047825 TTTTAGTTTGTTTGCTTTATTGG - Intergenic
966559829 3:181307955-181307977 TTCCAGTTCATTTTCCTTTTTGG + Intergenic
966674864 3:182573755-182573777 TTCCATTTTCTTTTCCTTCTGGG - Intergenic
966766367 3:183466000-183466022 GTCTAGTTTGTGTTCCAGGTTGG - Intergenic
967209206 3:187151566-187151588 TTCTTATTTTTTTTCTTTGTTGG - Intronic
967292732 3:187936911-187936933 TGCTTGTTTGTTTTCCTCTTTGG - Intergenic
967535063 3:190592583-190592605 TTCTACAAAGTTTTCCTTGTGGG - Intronic
967901198 3:194454089-194454111 TTTTTGTTTGTTTTGCTGGTTGG - Intronic
968439527 4:615805-615827 TACTTGTTTGTTTTCTTTGGGGG + Intergenic
969898107 4:10323662-10323684 TTCCAGTTAGTTTTCCCTGTGGG - Intergenic
970347549 4:15168163-15168185 TTATTCTTTGTTTTCCTTTTGGG + Intergenic
972103522 4:35452400-35452422 TTTTTGTTTGTTTTCCATTTTGG - Intergenic
972694629 4:41433641-41433663 TTCTGCTTTCTTTTCCTTGAAGG - Intronic
973972850 4:56231123-56231145 TTCTGATTTATTTTCCTTCTAGG + Intronic
974523191 4:63012338-63012360 TTTTAGTTGGTTTTGTTTGTGGG + Intergenic
974616230 4:64286132-64286154 TTTTGTTTTGTTTTCCTTGTGGG - Intronic
974908729 4:68088700-68088722 TTCTAGTTTGATTGCACTGTGGG - Intronic
975041262 4:69746927-69746949 TATTAGATTGTTTTCCTTTTTGG + Intronic
975509911 4:75182315-75182337 TTTTTGTTTTTTTTCTTTGTTGG - Intergenic
975677737 4:76843629-76843651 TTCTAATTTGTTTTTATTGCTGG + Intergenic
976135812 4:81935107-81935129 TTCTAGTTTGATTGCACTGTGGG + Intronic
976875841 4:89852505-89852527 TTCTTGTTTGTTTTACATATAGG - Intergenic
976912994 4:90331561-90331583 TTCTAGTAAGGTGTCCTTGTGGG - Intronic
977034319 4:91930312-91930334 TTTTTGTTTGTTTTCATTCTAGG + Intergenic
977153858 4:93548307-93548329 TTCTAGTATGTACTTCTTGTGGG - Intronic
977217531 4:94299442-94299464 TTCAAGTTTGTTTTTCTCGGGGG - Exonic
977737621 4:100436154-100436176 TTCTTGTTTAAGTTCCTTGTAGG - Intronic
978226692 4:106343708-106343730 TTCAAGTTAGTTTTGCTTGGTGG - Intronic
978320070 4:107483179-107483201 TTCTAGTTAGTTTGCCTTCCTGG - Intergenic
979061956 4:116074069-116074091 TTTTAGATTGTTTTCTTTCTAGG + Intergenic
979167006 4:117546978-117547000 TTATAGGTTTTTTTCTTTGTGGG - Intergenic
979675573 4:123406900-123406922 TTCTTGTTTGTTTGCTTTTTGGG + Intergenic
979739191 4:124128584-124128606 TTCTAGTTTTTTTTGCATGGAGG + Intergenic
979876154 4:125893884-125893906 TTCTATTTTGTTTTGGTTTTTGG - Intergenic
980009070 4:127576214-127576236 CTTTGTTTTGTTTTCCTTGTGGG - Intergenic
980644980 4:135632569-135632591 TTCTGGTTTGTTTTTATTTTGGG + Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981340408 4:143615732-143615754 TTCAATTTTGTTTTGTTTGTGGG - Intronic
981755310 4:148136101-148136123 TTTTTGTTTGTTTTTTTTGTTGG - Intronic
982047143 4:151459497-151459519 GTCTAGTTTGTTTTCCAAGTTGG + Intronic
982317367 4:154045362-154045384 TCCTAATTTGTCTTCTTTGTAGG + Intergenic
982365121 4:154569492-154569514 TTTTATTTTGTTTTTCTTTTAGG + Exonic
982877815 4:160670171-160670193 TTCTTTTTTGTTTTCTATGTGGG - Intergenic
982963501 4:161872119-161872141 TTGTAGTTTGTTTTTTTTTTTGG + Intronic
983078148 4:163351001-163351023 TTCAAGTCTGTTTTCTTTGTTGG - Exonic
983587218 4:169369054-169369076 TTGTAATTTGTTTACCTTGTTGG + Intergenic
983840984 4:172456318-172456340 GTCCAGTTTTGTTTCCTTGTTGG - Intronic
983950613 4:173635756-173635778 TTCCAGTTTATATTCATTGTTGG + Intergenic
984220978 4:176974421-176974443 TTCTATTATTTTTCCCTTGTTGG + Intergenic
984262282 4:177456507-177456529 TTCAGGTTTTTTTTCCTTCTTGG - Intergenic
984775278 4:183476424-183476446 TTCTGATTTGATTTCTTTGTCGG + Intergenic
985891531 5:2719486-2719508 TTCTAGTCTATTGTCTTTGTCGG + Intergenic
986093072 5:4530021-4530043 TTGCAGTTTGTTTAACTTGTAGG + Intergenic
986558120 5:9032300-9032322 TTGTATTTTTTTTTCCTTTTGGG + Intergenic
986803766 5:11288841-11288863 TTCTTTTTTTTTTTCCTTTTTGG - Intronic
987225880 5:15841172-15841194 TTTTTGTTTGTTTTGCTGGTTGG + Intronic
987384131 5:17312957-17312979 TTTTAGTTTTTTCTCCTTTTGGG + Intergenic
987634947 5:20527319-20527341 CTCTAGTGTGTTTTCCATCTCGG - Intronic
987747729 5:21998206-21998228 GTTTGGTTTGTTTTGCTTGTAGG - Intronic
987854758 5:23406015-23406037 TTTTAGTATGTATTCCGTGTGGG + Intergenic
988040065 5:25877521-25877543 TGCTACTTTCCTTTCCTTGTTGG + Intergenic
988057418 5:26116823-26116845 TTCTGGTATGTTTTCATTTTAGG - Intergenic
988767456 5:34396083-34396105 AACTAGTTTATTTTCTTTGTAGG - Intergenic
988977806 5:36532423-36532445 TTCTAATTTAATTTCATTGTAGG + Intergenic
989074562 5:37550305-37550327 TTCTAGTTTTACTTCATTGTGGG + Intronic
989204661 5:38798657-38798679 TTAGAGTTTAATTTCCTTGTGGG + Intergenic
989796578 5:45481954-45481976 TTTTTGTTTGTTTTTCTTTTAGG - Intronic
990001175 5:50894839-50894861 TTCCAAATTGTTTTCCTTTTGGG + Intergenic
990018246 5:51093169-51093191 TTTTAGTATGTTTTCCTTGGTGG + Intergenic
990272645 5:54160262-54160284 TTCTAACTTGTTTCTCTTGTTGG + Intronic
990857165 5:60281370-60281392 TTCTGTTTTGGTTTCCTTGGAGG - Intronic
990920131 5:60954808-60954830 TTTTAACTTGATTTCCTTGTTGG + Intronic
991134535 5:63165885-63165907 CTCTAGTTTTTTGGCCTTGTGGG - Intergenic
991193202 5:63900302-63900324 TTCTAATTTGATTCCATTGTGGG - Intergenic
991271523 5:64788435-64788457 ACCTAGTTTTTTCTCCTTGTGGG + Intronic
991298752 5:65107193-65107215 TTCTAGATTGTGCTCCTTGGAGG - Intergenic
991372020 5:65928244-65928266 TTCTTTTTTTTTTTCATTGTTGG + Intronic
991472725 5:66986044-66986066 TTTTTGTCTGTTTTCCTTGAGGG - Intronic
991699628 5:69305210-69305232 TTCTGGTTTTTTTTTCTTTTTGG + Intronic
991767909 5:70007999-70008021 GTTTGGTTTGTTTTGCTTGTAGG - Intergenic
991847143 5:70883077-70883099 GTTTGGTTTGTTTTGCTTGTAGG - Intergenic
992423435 5:76630070-76630092 TGGTAGTTTCTTTTCCTGGTTGG + Intronic
993307980 5:86293855-86293877 TTCTAGTTTAGTTTCCTAGGGGG - Intergenic
995209181 5:109517451-109517473 TTGTAATTTGTTTTCTTTCTTGG - Intergenic
995299172 5:110557973-110557995 TTATATTTTGATTTCCTTGAAGG + Intronic
995975038 5:118024701-118024723 TTCTTTTTTGTTTTTATTGTGGG - Intergenic
996377460 5:122827924-122827946 TTCTAGTTTGTTTTCCTTGTTGG + Intronic
996781770 5:127194557-127194579 TTCCTTTTTGTTTTTCTTGTTGG + Intergenic
997014592 5:129918009-129918031 TTTTGCTTTGTTTTCCTTTTGGG + Intronic
997065584 5:130555505-130555527 AGCTAGGTTGTTTTCCATGTGGG + Intergenic
997252423 5:132399227-132399249 GTCTAGTTTTGTTCCCTTGTTGG - Intergenic
999350135 5:150862130-150862152 TTCAAGAGTTTTTTCCTTGTTGG + Intronic
999488590 5:152026028-152026050 ATCTAGTTTTGTTTCCTTGCTGG + Intergenic
999694331 5:154175389-154175411 CTCTAGGATGTTTTCCTAGTGGG - Intronic
1000249912 5:159484270-159484292 TTTTAGTTTTTATTCCTTTTGGG - Intergenic
1000450894 5:161385477-161385499 TTCAAGATTTTTTTCTTTGTGGG + Intronic
1000517626 5:162258922-162258944 TTCTGTCTTTTTTTCCTTGTAGG - Intergenic
1000576207 5:162978494-162978516 ATCCTGTTTGTTTTGCTTGTAGG + Intergenic
1001237150 5:170039723-170039745 CTCTGGTTTATTTTCCTTTTGGG - Intronic
1001735267 5:173993139-173993161 TTCTAGTTTCTCTTCCCTGCTGG + Intronic
1002039880 5:176505158-176505180 TTCAAGTTATTTTTCCTTTTTGG - Intronic
1002154746 5:177267841-177267863 TTCTTGATTTTTTTCCTTATAGG + Intronic
1003017419 6:2479151-2479173 TCCCAGTTTGGTTTCTTTGTCGG + Intergenic
1003299636 6:4866139-4866161 TTCCGGTTTGTTTTCTTCGTTGG - Intronic
1003637576 6:7847211-7847233 TTGTAGTTTCTTTGCCTTCTAGG + Intronic
1004343164 6:14825283-14825305 TGCAAGTTTGTTTTCCTAATGGG - Intergenic
1004584624 6:16987569-16987591 TTTTACTATGTTTTCCTTTTTGG - Intergenic
1005215642 6:23524650-23524672 TTCTAGTTTTCTTTCTTTTTTGG + Intergenic
1005233769 6:23735915-23735937 TTTCAATTTGTTTTCCTTGGGGG + Intergenic
1005410700 6:25542609-25542631 TTCAAGTTTCTTTTCCTTTGGGG + Intronic
1005469489 6:26148294-26148316 TTCTAGTTTTTTTTCTTTATAGG - Intergenic
1006004952 6:30994203-30994225 TTCTAGTTTTGTTATCTTGTTGG + Intergenic
1006270418 6:32961384-32961406 TTCTATTTTGTTTTTTTGGTGGG - Intronic
1006285039 6:33086250-33086272 TCCTGCTTTGATTTCCTTGTGGG + Intronic
1006290195 6:33129096-33129118 TCCTGCTTTGATTTCCTTGTTGG + Intergenic
1006716993 6:36126925-36126947 CTCTAGTCTGCTTTCCTTCTAGG + Intergenic
1008399366 6:51046990-51047012 TTTTTGTTTGTTTTTTTTGTGGG + Intergenic
1008464374 6:51814434-51814456 TTTTTGTTTGTTTTCTTTTTTGG - Intronic
1008499110 6:52162635-52162657 TTCTAGTTTATTCTCCTTGTTGG + Intergenic
1008684837 6:53913979-53914001 TTGTAGTTTGCTTTGCTTGAGGG + Intronic
1009659008 6:66585920-66585942 TTCTACTTTTTTTTCCCTTTGGG + Intergenic
1009685617 6:66952571-66952593 TCCTTATTTGTTTTCTTTGTTGG + Intergenic
1010034339 6:71306095-71306117 TTCTATTTTGTTTTCCACTTAGG + Exonic
1010039013 6:71360341-71360363 GTCTAGTTTTTTTCCCTTGCTGG + Intergenic
1010252563 6:73723229-73723251 TTCTTTCCTGTTTTCCTTGTAGG + Exonic
1010357465 6:74950786-74950808 TTTTATTATGTTTTCCTTTTTGG - Intergenic
1010376034 6:75171639-75171661 TTCTAATTTGTTTTTCTCTTGGG - Intronic
1010988918 6:82457842-82457864 TTCAAGTGTGTTTTCATGGTAGG + Intergenic
1011025094 6:82859882-82859904 TTCTGGTATTTTTTGCTTGTTGG - Intergenic
1011947003 6:92917965-92917987 TTCTATTTTATTTTCCCTCTTGG - Intergenic
1012267632 6:97165457-97165479 TTCTTACTTTTTTTCCTTGTAGG - Exonic
1012268213 6:97173617-97173639 TACTTGTAGGTTTTCCTTGTAGG - Intronic
1012755111 6:103220292-103220314 TTCTAGTTTCATTCCATTGTGGG - Intergenic
1012836052 6:104270064-104270086 TTAGACTTTGTTTTCCTTGCTGG + Intergenic
1013005253 6:106066732-106066754 TTCTAGTCTTTTTTTCCTGTGGG + Intergenic
1013021654 6:106227095-106227117 TTTTAGTTTGTTTATCTTCTTGG - Intronic
1013606563 6:111754663-111754685 TTCTCATTTGCTTTCCTTGAGGG + Intronic
1013825803 6:114209861-114209883 TTCAAGTTTGTTCTCCTTTCAGG + Intronic
1013957043 6:115853427-115853449 TTCCAGTTTTGTTTCCTTGTTGG - Intergenic
1014113506 6:117646697-117646719 ATCCAGTTTTGTTTCCTTGTTGG - Intergenic
1014470874 6:121813310-121813332 TTTTGCTTTGTTTACCTTGTAGG - Intergenic
1015310327 6:131760085-131760107 TTCTGGTTTGTTTTTGCTGTGGG + Intergenic
1015481700 6:133718849-133718871 GGTTAGGTTGTTTTCCTTGTGGG - Intergenic
1016332680 6:142970243-142970265 TTCAAGTTTATTTTCTTTTTTGG + Intergenic
1016541760 6:145173670-145173692 TTCTTGTTGGTTTTCTTTCTGGG - Intergenic
1016590483 6:145738061-145738083 TTTTAGATCTTTTTCCTTGTTGG + Intergenic
1016774386 6:147888981-147889003 TTCTAATTTGTTGACCTTTTTGG + Intergenic
1017372246 6:153725520-153725542 TTCTCCTTTGTTTTCCTCTTTGG - Intergenic
1017555037 6:155554996-155555018 TTCTAGTTTATCTTCATTTTTGG + Intergenic
1017580178 6:155856075-155856097 TTATAGTTTGTTCTTGTTGTAGG - Intergenic
1018162739 6:161063124-161063146 TTCTAGTTTGTTTTTGATTTGGG + Intronic
1019122918 6:169819014-169819036 TTCTAGTTTGGTGTACTTTTAGG + Intergenic
1019255240 7:45655-45677 TTTTTGTTTCTTTTCCCTGTAGG - Intergenic
1019566678 7:1685079-1685101 TTTTAGTTTGCTTTCATTCTTGG + Intergenic
1019753554 7:2750202-2750224 TTGCAGTTTGTTCTCCTTGCCGG - Intronic
1019948366 7:4348663-4348685 TTCTGGAATGTTTTGCTTGTTGG + Intergenic
1020698771 7:11450170-11450192 TTTTATTTTGTTTTTCTTTTTGG - Intronic
1021702424 7:23332594-23332616 TTTTATTTTGTGTTCTTTGTTGG - Intronic
1022366692 7:29727730-29727752 TTCTAGTTTTTTTTCCATTGTGG + Intergenic
1022817520 7:33927895-33927917 TTCCTTTTTGTTTTCCTTTTGGG + Intronic
1024888034 7:54167141-54167163 ATCTATTTTTTTTTCCTTCTAGG - Intergenic
1026061634 7:67031721-67031743 TTCTAGTTGGTTTAGTTTGTGGG - Intronic
1026103735 7:67404089-67404111 CTCTAGTTTATTTTCCTGCTGGG + Intergenic
1026139422 7:67692720-67692742 TTCTTGTTTGTTTGCTTGGTTGG - Intergenic
1026716716 7:72795713-72795735 TTCTAGTTGGTTTAGTTTGTGGG + Intronic
1027385773 7:77658568-77658590 TTTTAGATTGTTTTCCTTTTTGG - Intergenic
1027438873 7:78196777-78196799 TTTTAATTTGTTTTCTATGTGGG + Intronic
1027545492 7:79522714-79522736 TTCTAGATTGTTTTCCAGTTTGG + Intergenic
1027565717 7:79790552-79790574 TTTTTGTTTGTTTTCATTTTTGG - Intergenic
1027844173 7:83350722-83350744 TTCTATATTGTTTTCCTTTAAGG - Intergenic
1027927296 7:84482859-84482881 TTCTAGTTTTTTTTTTTTTTTGG + Intronic
1028087196 7:86650848-86650870 TACCAGCTTGTTTTCCTGGTGGG - Intronic
1028213996 7:88109447-88109469 TTCTTGTTTGTTTTACTTTTTGG + Intronic
1028441059 7:90861318-90861340 TTTTTATTTGTTCTCCTTGTTGG - Intronic
1028549693 7:92046187-92046209 TTCAATTTCTTTTTCCTTGTAGG + Intronic
1029825589 7:103189813-103189835 TTCTAGTTTTTTTTCCATTGTGG - Intergenic
1030164159 7:106536169-106536191 TTCTAGCTGGTTTTTGTTGTAGG + Intergenic
1030294674 7:107910234-107910256 TTCTACTTTGTTCTCATAGTTGG + Intronic
1031126581 7:117780320-117780342 CTTTATTTTGTTTTGCTTGTAGG - Intronic
1031165548 7:118223557-118223579 TTCCTGTTTGTTTTCTTAGTAGG + Intronic
1033669170 7:143473697-143473719 TTATAGGTTTTTTTCTTTGTGGG - Intergenic
1035347698 7:158215636-158215658 TTGAATTGTGTTTTCCTTGTAGG - Intronic
1035793405 8:2329459-2329481 TTCTCGTTTGATTTCCTTTTGGG + Intergenic
1035799399 8:2392246-2392268 TTCTCGTTTGATTTCCTTTTGGG - Intergenic
1036118056 8:5981855-5981877 TTGGAGTTTGTTATGCTTGTTGG - Intergenic
1037102882 8:15069193-15069215 TTCTTGTTTGTTTTGTTTTTTGG + Intronic
1039721702 8:40171345-40171367 TTCTAGTTGCTTTTCCTTTTTGG - Intergenic
1040347752 8:46525184-46525206 TTCTAGTTTTTTTTTTTTGTAGG - Intergenic
1040880868 8:52202883-52202905 GTTTAGTTTCTTCTCCTTGTAGG - Intronic
1041360668 8:57050136-57050158 TTCTAGATTGTTTATCTTTTAGG + Intergenic
1041908213 8:63056673-63056695 TTCTAGTTTTGTTCCATTGTGGG + Intronic
1042043768 8:64624539-64624561 ATCTTTTTTTTTTTCCTTGTAGG - Exonic
1042891422 8:73615968-73615990 TTTTAGCTTGTTTTCCTTGAAGG + Intronic
1042979645 8:74510889-74510911 GTCTAGTTTTGTTTCCTTTTGGG - Intergenic
1043255680 8:78134093-78134115 TTTGAGTTTATTTTTCTTGTTGG - Intergenic
1044001610 8:86888854-86888876 TTCTAGTTTTTTTTTCTCTTTGG + Intronic
1044344249 8:91085709-91085731 TTCTACTTTGCTTTCCTTGAAGG + Exonic
1045813227 8:106248866-106248888 TTCTAGTGTATTTTCTATGTTGG - Intergenic
1046257256 8:111717826-111717848 TTTTAGTTTGTTTTATTTTTTGG - Intergenic
1046308508 8:112401593-112401615 TTTTGGTTTGTTTTCATTGTTGG - Intronic
1046525260 8:115375017-115375039 TTCTATTTGGTTTTCCTTTATGG - Intergenic
1046712965 8:117533864-117533886 TTCTTGGTTTTCTTCCTTGTTGG + Intronic
1046873891 8:119232922-119232944 TTCTAGTTTGATTGCACTGTGGG + Intronic
1046988090 8:120413577-120413599 TTTTATTTTGTTTTTCTTTTTGG + Intronic
1048260081 8:132937921-132937943 TTTTGGTTTGTTTTCCTTTTTGG + Intronic
1048492820 8:134910528-134910550 TTCTCTTTTATTTTCCTTGAAGG + Intergenic
1048657612 8:136558989-136559011 TTCTAATTTCTTTTCCTTTATGG + Intergenic
1049092027 8:140523300-140523322 TTCTAAAATGTTTTCATTGTGGG + Intergenic
1050635672 9:7609751-7609773 TTCTGGATTGTTTTTCTTATTGG + Intergenic
1051035542 9:12740711-12740733 TTCTGGTTTGTTTTCCTGGGTGG + Intergenic
1051129019 9:13838242-13838264 TTTTGTTTTTTTTTCCTTGTGGG - Intergenic
1051900628 9:22035411-22035433 TGTTTGTTTATTTTCCTTGTTGG + Intergenic
1051942907 9:22530288-22530310 TTCTATTTTTTTTTCCATTTTGG - Intergenic
1052155547 9:25184247-25184269 TTTTCATTTGTTTTCTTTGTCGG - Intergenic
1053370730 9:37559576-37559598 TTCCAGTTTTCTTTCCTTCTGGG + Intronic
1053615487 9:39761415-39761437 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1053873653 9:42520678-42520700 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1053898968 9:42773870-42773892 TGCTAGTTGGATTTCCATGTGGG + Intergenic
1054238033 9:62580976-62580998 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1054262546 9:62882349-62882371 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1054268679 9:62946078-62946100 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1054552164 9:66615486-66615508 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1054786179 9:69212361-69212383 TTCTAGTTTCATTTCATTGAAGG + Intronic
1055161398 9:73132826-73132848 TACTAATCTGTTTTCCTTATGGG + Intergenic
1055334259 9:75216979-75217001 TGCTATTTTGTTTTGCCTGTAGG + Intergenic
1055841289 9:80507404-80507426 TCCTTGTTTCTTTTCCCTGTTGG + Intergenic
1056033204 9:82575136-82575158 TTGTAGTTTGTTGTGCTTCTTGG - Intergenic
1056087402 9:83164605-83164627 TTCTTTTTTTTTTTCCTTGGTGG - Intergenic
1056386434 9:86100289-86100311 TTCTAGCATGGTTTCCCTGTAGG - Intergenic
1057326904 9:94073919-94073941 TTCTAGTTTGATTTCATTGTGGG + Intronic
1057394690 9:94669374-94669396 TTCTAGTTTGTATTAACTGTGGG - Intergenic
1058024327 9:100124137-100124159 GTATAGTTTGTTTTCATTGGAGG + Intronic
1058249980 9:102681241-102681263 TTCTGTTTTGTTTTCCATTTTGG - Intergenic
1058867395 9:109173584-109173606 TTCTCCTTTGTTTTACTTCTCGG - Exonic
1059913606 9:119074478-119074500 CTCTGCTTTGCTTTCCTTGTGGG + Intergenic
1059990582 9:119861538-119861560 TTCTTGGTTTTTTTCCTTCTTGG - Intergenic
1060428771 9:123529065-123529087 TTCATGTTTGTTTTCCTTATAGG + Intronic
1060570191 9:124631607-124631629 TTTTAGTTTTTTGTCTTTGTGGG - Intronic
1062181300 9:135192591-135192613 TTCTAGTTTCCTTTCCTTCCTGG - Intergenic
1185525649 X:776537-776559 TTTTATTTTTTTTTCCTTTTCGG - Intergenic
1185569145 X:1119775-1119797 TTCTTGTTCCTTTTCCTTGAAGG - Intergenic
1185719267 X:2369493-2369515 TTTTTGTTTGTTTTTCTTTTTGG + Intronic
1185812889 X:3126892-3126914 TTTTTGTTTGTTTTGTTTGTTGG - Intergenic
1185932726 X:4220808-4220830 TTCTATTTGGATTTCCTTTTAGG + Intergenic
1186304267 X:8238112-8238134 TTTTATTTTGTTTTCTTTGCAGG + Intergenic
1186424724 X:9455004-9455026 TTTTGGTTTGCTTTCCATGTTGG + Intergenic
1186812167 X:13201071-13201093 TTATAGTTTTATTGCCTTGTAGG + Intergenic
1187169474 X:16837017-16837039 TTATATTTTGCTTGCCTTGTTGG + Intronic
1187630630 X:21166538-21166560 TTCCAGTTTGTTCTACTTGGTGG - Intergenic
1187884886 X:23880363-23880385 TTATAGTTTGTTTAATTTGTGGG - Intronic
1188417305 X:29951365-29951387 TTTTAGCTTGTTTTCCTTGAAGG - Intronic
1188932481 X:36129076-36129098 ATCTAGATTTTTTTCTTTGTAGG + Intronic
1189322070 X:40092736-40092758 TTATAGTTTCTTTCCCTTCTAGG - Intronic
1189808178 X:44755711-44755733 TTCTATTTTATGTTCCTTTTTGG + Intergenic
1190976607 X:55409436-55409458 ATTTGGTTTGTTTTGCTTGTAGG + Intergenic
1191259719 X:58303137-58303159 TTCTCTTTTGTTTTTATTGTGGG - Intergenic
1191983523 X:66953031-66953053 TTCTAGTTTATTTGCATTGAGGG - Intergenic
1192395156 X:70772997-70773019 TGCTTGTTTGTTTTCCTTTATGG - Intronic
1192663062 X:73062464-73062486 TTCTAGTTTGATTGCACTGTGGG - Intergenic
1193165250 X:78273197-78273219 TTTTAGTTTGATTGTCTTGTGGG + Exonic
1193682257 X:84536985-84537007 TTTTATTTTGTTTTCTTTGTGGG - Intergenic
1193783948 X:85735796-85735818 TGCTATTTTTTTTTTCTTGTGGG + Intergenic
1193883934 X:86961275-86961297 TCCTAGTTTATTTTTATTGTAGG + Intergenic
1193928732 X:87524960-87524982 TTGTTGTTTGTTTTGCTTGTTGG + Intronic
1194006017 X:88492739-88492761 TTCTAGGTTTTTATTCTTGTTGG + Intergenic
1194783536 X:98054601-98054623 TTGTAGTTTTATTTCATTGTGGG + Intergenic
1195055136 X:101137225-101137247 TTCTAATTTGTTTCTTTTGTCGG + Intronic
1196072119 X:111537057-111537079 TCCTATTTTATTTTCCTTGTTGG - Intergenic
1196395010 X:115250346-115250368 TTCTATTTTATCTTCTTTGTTGG - Intergenic
1196567598 X:117227258-117227280 TTTAATGTTGTTTTCCTTGTTGG + Intergenic
1196658141 X:118241370-118241392 TTCCAGTTTGTTTCCTTTGTTGG + Intergenic
1196661285 X:118272533-118272555 ATCTTTTTTGTTTTCCTTTTTGG - Intergenic
1196870894 X:120112705-120112727 TTGAAGTTTGGGTTCCTTGTCGG - Intronic
1197586481 X:128354001-128354023 ATTTAGTTTGCTTTCCCTGTTGG + Intergenic
1197880632 X:131163433-131163455 GTCTAGTTTTGTTTCCTTGCTGG + Intergenic
1198050884 X:132952617-132952639 TTCTATTTTTTTTTAATTGTGGG - Intronic
1198688667 X:139255615-139255637 GTCTAATTTGATTTCATTGTGGG + Intergenic
1198708927 X:139480136-139480158 TAGCAGTTTGTTTTCCTTTTCGG - Intergenic
1199308446 X:146294622-146294644 TTCTAGCTTTATTTCATTGTGGG + Intergenic
1199425909 X:147700704-147700726 TGCTAATTTGAGTTCCTTGTAGG - Intergenic
1199605608 X:149576500-149576522 TTCAAAGTTGATTTCCTTGTAGG + Intergenic
1199633513 X:149792868-149792890 TTCAAAGTTGATTTCCTTGTAGG - Intergenic
1200755939 Y:6990152-6990174 TTTTAATTTTTTTTCCTTCTTGG + Intronic
1200860205 Y:7983257-7983279 TGTTTGTTTGTTTTCCCTGTTGG + Intergenic
1200933305 Y:8716321-8716343 TTCATGACTGTTTTCCTTGTAGG - Intergenic
1201405840 Y:13649255-13649277 TGGTAGTTTGTATTTCTTGTGGG + Intergenic
1201713681 Y:17019698-17019720 TTCTATTTGGATTTCCTTTTAGG + Intergenic
1201752132 Y:17444750-17444772 GTCTAGTTTTGTTTCCTTGCTGG + Intergenic