ID: 996382898

View in Genome Browser
Species Human (GRCh38)
Location 5:122880075-122880097
Sequence CAAAGTAAACAGAAGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996382898 Original CRISPR CAAAGTAAACAGAAGGTTGG AGG (reversed) Intronic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
901663058 1:10810881-10810903 AAATGAAAGCAGAAGGTTGGAGG - Intergenic
901803519 1:11723327-11723349 CAAACAAAACAGAAGCTTTGTGG - Exonic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
905011924 1:34753423-34753445 CATTGTAAACAGAAGCTTGCAGG + Intronic
905392615 1:37647374-37647396 AAAAGCAAACAACAGGTTGGAGG - Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
906984099 1:50664495-50664517 ACAACTAAACAGAAGGCTGGGGG + Intronic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
907651220 1:56296545-56296567 CAAAGTAAAGAGGAGCTTTGGGG - Intergenic
907987676 1:59548254-59548276 CAAAGTAAACAAATGCTTAGTGG + Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910250204 1:85189601-85189623 CAAAGTAGGCAGATGGTTTGAGG + Intronic
910997795 1:93127805-93127827 AAAAGTAAAAATAAGGTAGGGGG - Intronic
912452518 1:109776145-109776167 GAAAGGAAACAGAAGTTAGGAGG + Intergenic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913275788 1:117136690-117136712 CAAAGAAAAAAAAAGGGTGGGGG + Intergenic
915062373 1:153196917-153196939 AAAAGGAAACAGAAGCCTGGTGG + Intergenic
915877480 1:159627033-159627055 CAAAGTAAGCAGAAGGTGATTGG - Intergenic
916101738 1:161399036-161399058 CACAGTAAAGACAAGTTTGGGGG + Intergenic
916997163 1:170313378-170313400 CAAAGTAAATAAAAGGATAGAGG - Intergenic
917215304 1:172671854-172671876 TAAAGTTAACTGAAGGTTTGAGG + Intergenic
917237416 1:172909364-172909386 CATACTAAAAAAAAGGTTGGTGG + Intergenic
917337150 1:173936529-173936551 AAAAAAAAAAAGAAGGTTGGAGG + Exonic
918440666 1:184563787-184563809 GAAAGAAAATACAAGGTTGGGGG + Intronic
919178707 1:194054070-194054092 CAAAATATACAGAAGGTAGTTGG - Intergenic
919698115 1:200600573-200600595 CAAATGAAATAGAAGATTGGAGG - Intronic
920858382 1:209683513-209683535 AAAAGTAAACAGAGAGTAGGAGG - Intergenic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923943784 1:238859695-238859717 AAAAGAAAAGAGAAGGCTGGAGG + Intergenic
924189778 1:241538349-241538371 CAAGGTAGAAAGAGGGTTGGTGG + Intronic
924609510 1:245562218-245562240 CAAATTAAACAGCAGATTAGAGG + Intronic
1063246314 10:4223321-4223343 CAAAGTCAAAAGAAGATGGGTGG - Intergenic
1063490219 10:6457273-6457295 CCAAGGAAACAGAAGTTTGTTGG - Intronic
1066473356 10:35720754-35720776 CAAATTAAATGGAAGGTTGAAGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068862708 10:61864152-61864174 CCAAGGAAAGAGAAAGTTGGAGG - Intergenic
1069664319 10:70144894-70144916 CTACGTAATCAGAAGGTAGGGGG - Intronic
1070680005 10:78442345-78442367 CAAAGTAAACAGAGGATTGTGGG - Intergenic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1072265654 10:93724669-93724691 CAAAGGAAACTGAAGGCTTGAGG - Intergenic
1074767257 10:116708368-116708390 CAAGGAAACCAGAAGGTTTGAGG + Intronic
1077710957 11:4536435-4536457 CTAAGCAAAAAGAAAGTTGGAGG + Intergenic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1080431607 11:32204759-32204781 CAAAGCCAACAGGATGTTGGAGG + Intergenic
1083032916 11:59610610-59610632 CAATTTAAACAGAAAGTTGACGG + Intronic
1084341134 11:68502475-68502497 CCAAGTAAACAGTGGGTTGGAGG + Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085270670 11:75267947-75267969 CAAAAGAAACAGAAGTTTAGAGG - Intronic
1087031579 11:93711135-93711157 CAAATCAAACCTAAGGTTGGTGG - Intronic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088377411 11:109158070-109158092 CAAAGTTAACTAAAGGTTTGTGG - Intergenic
1091142363 11:133246130-133246152 AAAATTAAAAAGAAGCTTGGTGG + Intronic
1091176918 11:133567478-133567500 CAAACTTAACAGCAGATTGGAGG + Intergenic
1091560635 12:1610293-1610315 CACAGGCAAGAGAAGGTTGGAGG - Intronic
1093013759 12:14135687-14135709 GAAAGTAAACAGAAGCTTATTGG + Intergenic
1093701006 12:22220656-22220678 CAAAGTAAAAACAGTGTTGGGGG + Intronic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095698947 12:45171203-45171225 CAAAATAATCAGAAGGTTGCTGG + Intergenic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1095853480 12:46835516-46835538 AAAAATAAAGAGAAGATTGGTGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097152946 12:56993164-56993186 GACAGGAAGCAGAAGGTTGGTGG + Intergenic
1097236562 12:57544292-57544314 CAAAGTATACAGGAGGGTGTAGG - Intronic
1097430905 12:59505569-59505591 AAAAATGAAGAGAAGGTTGGAGG - Intergenic
1097462189 12:59875247-59875269 GAAAGTGAACAGGAGGTTTGTGG - Intergenic
1097605990 12:61755075-61755097 CTAATTAAAAAGAAGGGTGGGGG - Intronic
1099177777 12:79441613-79441635 AAAAGAGAACAGAGGGTTGGGGG - Intronic
1099413192 12:82357819-82357841 CAAATTAAAGCGAAGGCTGGAGG + Intronic
1101546432 12:105717775-105717797 TAAAGTAAAAATTAGGTTGGTGG - Intergenic
1101921874 12:108939692-108939714 AAAAGGAAACAGAATGTTGGTGG - Intronic
1102577055 12:113862449-113862471 AAAAGAAAAAAAAAGGTTGGGGG + Intronic
1107577485 13:41742702-41742724 CAAAGTAAACTGAATTTAGGAGG - Intronic
1107693530 13:42977382-42977404 CTAACTATACAGAAGGTTGGTGG - Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1110255229 13:73426124-73426146 CTATTTAAAAAGAAGGTTGGGGG - Intergenic
1110613875 13:77519906-77519928 CAAAGAAACAAGAAGGCTGGAGG + Intergenic
1110688633 13:78405049-78405071 CAAAGGAAACAGAAGCTGAGTGG + Intergenic
1111146993 13:84195272-84195294 AAAAGTGAAAAGAAGCTTGGAGG - Intergenic
1113553212 13:111209302-111209324 CAAAGTAAACAGACAGTAAGAGG - Intronic
1113832171 13:113304585-113304607 CAAAGCAGACAGTAGATTGGAGG + Intronic
1115770534 14:36661312-36661334 CAAAGAAACCAGGAGGTTGCGGG - Intronic
1115824949 14:37259899-37259921 ACAAGTAAAGAAAAGGTTGGTGG - Intronic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116538085 14:46061435-46061457 TAAAATGAACAGAAGGTAGGTGG + Intergenic
1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1122983680 14:105202687-105202709 CAAGGTGAACAGACGGCTGGAGG - Intergenic
1124085076 15:26542003-26542025 TACAGCAAACAGAAGGTGGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126600993 15:50427379-50427401 GAAAGTAAACTGAAGAGTGGTGG + Intronic
1127303591 15:57681327-57681349 CAAAGGAAACCAAAGGTTGGAGG - Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1129625617 15:77195442-77195464 CAAAATAAATAAAAGGTAGGAGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1132157714 15:99508117-99508139 CAAAGTACAGAGAAGATTGATGG - Intergenic
1132506474 16:312078-312100 CTAAGAAACCAGTAGGTTGGTGG - Intronic
1132849290 16:2017301-2017323 CAAACAAAACAGAAGGTCTGGGG - Intronic
1134541035 16:15065748-15065770 CAAAAGAATTAGAAGGTTGGTGG + Intronic
1135436487 16:22430292-22430314 CAAAAGAATTAGAAGGTTGGTGG + Intronic
1136263770 16:29101623-29101645 CAAAAGAATTAGAAGGTTGGTGG - Intergenic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137380848 16:47998250-47998272 CAAAGAAAAAAAAAGTTTGGAGG + Intergenic
1137866954 16:51907687-51907709 AAAAACAAAAAGAAGGTTGGAGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1141992425 16:87618218-87618240 TAAAGAAAACAGAAAGTGGGAGG + Intronic
1142523797 17:523474-523496 CAAAGTAAATAGGAAATTGGAGG - Intronic
1143075288 17:4337357-4337379 AAAAGGAAAAAGAAGGCTGGGGG + Intronic
1143806519 17:9432803-9432825 GAAAGTACACAGAAGGTTAGAGG - Intronic
1144479393 17:15616502-15616524 CTAAGAAAAGAGAAGGTTGTTGG + Intronic
1144640980 17:16936330-16936352 GAAAGAAAACAAAAGGTGGGTGG + Intronic
1144646807 17:16980789-16980811 CAAAGGAATCAAAAGCTTGGGGG - Intergenic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1144918911 17:18747224-18747246 CTAAGAAAAGAGAAGGTTGTTGG - Intronic
1146635981 17:34505055-34505077 CCAAGTATTGAGAAGGTTGGTGG - Intergenic
1148088620 17:45009374-45009396 CAAAGAAACCACAGGGTTGGTGG + Intergenic
1151837312 17:76590877-76590899 CTAAGTAAACAGAAAGTAAGAGG - Intergenic
1152387609 17:79984411-79984433 AAAAGTAAACACAAGGCTGAAGG + Intronic
1153188626 18:2513890-2513912 CAAAGTAAACAGAATGTCTGGGG - Intergenic
1153668123 18:7384540-7384562 CAAAGTTTGCAGAGGGTTGGAGG - Intergenic
1155718120 18:28971965-28971987 CAAAGTAAAAACAAGAGTGGTGG + Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156916702 18:42470446-42470468 CAAATGAAATAGAAGGTGGGAGG - Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157909960 18:51607374-51607396 AAAAGAAAACTGGAGGTTGGGGG + Intergenic
1158369520 18:56784121-56784143 GAAAGAAAACAAAAGGCTGGGGG - Intronic
1160401213 18:78612704-78612726 CAAAGTCAACACAAAGCTGGGGG + Intergenic
1162759538 19:12880664-12880686 CAAAGAAAAAAAAAAGTTGGGGG + Intronic
1163731160 19:18950087-18950109 AAAAGTCAGCAGAAGGCTGGAGG + Intergenic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926998608 2:18768419-18768441 CAAAGTAGCCAGAAGGTAGGGGG - Intergenic
928036409 2:27828303-27828325 AAAAGAAAAAGGAAGGTTGGAGG + Intronic
929016502 2:37502667-37502689 CACAAGAAAAAGAAGGTTGGTGG + Intergenic
929574909 2:43045373-43045395 CAAAGGAAAAAGAAAGTTGGGGG - Intergenic
931155604 2:59625169-59625191 TAAAAGAAACAGAAAGTTGGTGG - Intergenic
932073660 2:68644206-68644228 CAAAGAATACAGAAGCTTCGGGG - Intronic
932736954 2:74260968-74260990 CAAAACAAATAGGAGGTTGGGGG - Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
934161278 2:89252122-89252144 ATAAGTAAACAGAAGGCTTGAGG + Intergenic
934206001 2:89930293-89930315 ATAAGTAAACAGAAGGCTTGAGG - Intergenic
936260006 2:110950637-110950659 CAAGGAAACAAGAAGGTTGGTGG + Intronic
937024186 2:118683652-118683674 CAAAGTCAACAGGATGGTGGAGG + Intergenic
937962370 2:127470001-127470023 CCAAGAAGATAGAAGGTTGGAGG - Intronic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939580196 2:143937730-143937752 AAAAGGAAACAGAACGCTGGGGG + Intergenic
940039043 2:149340471-149340493 CAATGTAGAGGGAAGGTTGGAGG + Intronic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
941033794 2:160543639-160543661 CAACGTATACTGAAGGTTTGGGG + Intergenic
942855501 2:180541741-180541763 CAAAGTAATGAGTAGGGTGGGGG - Intergenic
943869219 2:192972591-192972613 CAAAAGTAACAGAAAGTTGGTGG + Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
946125301 2:217557492-217557514 CAAAGCCAACAGGATGTTGGAGG - Intronic
948495000 2:238342665-238342687 AAAAATAAACATAAGTTTGGCGG - Intronic
948687686 2:239679308-239679330 CAAAGTCAACAGAATCTTTGTGG - Intergenic
948726374 2:239936494-239936516 TAAAGTAAACTGCAGGCTGGGGG + Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170727980 20:18946940-18946962 AAAAGCAAAAGGAAGGTTGGAGG + Intergenic
1171073296 20:22097027-22097049 AAAAGTAAACATGAGGCTGGGGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172748007 20:37228217-37228239 CAAAGTGACCAAAAGGCTGGCGG + Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174334880 20:49852830-49852852 CAAAACAAACAAAAGGCTGGGGG - Intronic
1176997189 21:15569219-15569241 CTAGGTAAATAGAATGTTGGAGG - Intergenic
1177101543 21:16903070-16903092 AAAAGTAGACAAAAGGTTGATGG - Intergenic
1178935500 21:36858439-36858461 TACAGAAAACAGAAGATTGGGGG + Intronic
1179073787 21:38098793-38098815 TAAAGTAGACAGAAAGTTTGGGG + Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1183123602 22:35752737-35752759 CAAAGGAAAGAAAAGGCTGGTGG - Intronic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
951464132 3:22983748-22983770 AAAAGAAACCAGAAGGTTGGAGG + Intergenic
951580621 3:24158964-24158986 CAAAGTCATCAGAAGATTAGGGG + Intronic
952207561 3:31195453-31195475 CAAAGTCAATAGAAGGTTGATGG + Intergenic
952553137 3:34501626-34501648 AAAAGTAACCTGAAGGTAGGGGG - Intergenic
953497529 3:43401137-43401159 CAAACAAAACAAAAGGCTGGGGG - Intronic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
954011697 3:47645561-47645583 AAAAGTAACCTGAAGTTTGGGGG - Intronic
954349419 3:50030493-50030515 TAAAATAAACAGAAAGTTGTAGG - Intronic
954954274 3:54505457-54505479 CAAAGTAAAGAGTAGGGTAGAGG - Intronic
955928400 3:64030693-64030715 CAAGGTGCACAGGAGGTTGGTGG + Intergenic
958101317 3:89015134-89015156 AAAAGTGCACAGAAGGTTTGGGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959562150 3:107795222-107795244 CAAAGCAGACAAAAGCTTGGTGG - Intronic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
959844299 3:111015067-111015089 CAAACTAAACACAAGTTTGTCGG + Intergenic
962144388 3:132824756-132824778 AAAACTGAACAGAAGGTTGAAGG - Intergenic
962176476 3:133160693-133160715 CAAAGTCAACAGAGGTTTGAAGG - Intronic
963513210 3:146275368-146275390 TAAAGTACAGAGAAGTTTGGGGG - Intergenic
964637122 3:158870318-158870340 CAAAGAAGACGGAAGCTTGGGGG - Intergenic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
969349665 4:6591150-6591172 CAAAAAAAAAAGAAGGCTGGAGG + Intronic
971115026 4:23635764-23635786 AAAAGACAACAGAATGTTGGTGG + Intergenic
973018142 4:45166982-45167004 TAAGTTATACAGAAGGTTGGAGG - Intergenic
973777783 4:54258965-54258987 CAAAGGGAACTGAAGGTTTGTGG - Intronic
976050045 4:81000941-81000963 CAAAGCAATGGGAAGGTTGGGGG - Intergenic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
976710062 4:88060656-88060678 CAAAGTAAAAAAAAAGTTGGTGG + Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
979292549 4:118993751-118993773 CAAAGTAAAAAGTAATTTGGGGG - Intronic
979602735 4:122604229-122604251 CAAAGCATGCAGAAGATTGGGGG - Intergenic
980752023 4:137103125-137103147 AAAAGTAAATACAAAGTTGGAGG + Intergenic
981234794 4:142402471-142402493 CAAAGCAAACAGAAGGTAATTGG - Intronic
982538205 4:156633369-156633391 CAAAGTAAACAGAAAGTTTAAGG - Intergenic
983882718 4:172951393-172951415 TGAAGGAAGCAGAAGGTTGGTGG - Intronic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986413078 5:7501682-7501704 CAAAGGAAAAAGAATGTTGCAGG + Intronic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
988140548 5:27233521-27233543 CAAAATAAACATAAGGGTGCGGG + Intergenic
988410643 5:30881392-30881414 CAAAGTGAACACAAAGATGGAGG - Intergenic
988802839 5:34712826-34712848 CAAAGAAAAAGGAAGGTTGTGGG + Intronic
990199563 5:53356146-53356168 CAAAGTTAACAGAAGACTGTGGG - Intergenic
990372914 5:55138584-55138606 CAAAGTAAATGGGGGGTTGGAGG + Intronic
990405385 5:55484890-55484912 CAATGGACACTGAAGGTTGGAGG + Intronic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
991195851 5:63931202-63931224 CAAAGGAAAGAGAAGCTTGATGG + Intergenic
991995376 5:72381267-72381289 CTAAGTATAAAGAATGTTGGGGG + Intergenic
992390310 5:76325164-76325186 GAAAGTCAACAGAGGGCTGGAGG + Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994986682 5:106942053-106942075 CAAAGTACTTAGCAGGTTGGAGG + Intergenic
995099740 5:108285277-108285299 AACATTAAACAGAAGCTTGGAGG - Intronic
995449666 5:112286697-112286719 GAAAGAGAACAGAAGGTTGCTGG - Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996885620 5:128350558-128350580 AAAAGTAAACAAAAGATTTGAGG + Intronic
997908513 5:137844640-137844662 CAAAGGAAATAGAAGTTTGAGGG + Intergenic
998438947 5:142139700-142139722 CAAAGTCAAGACAAGGCTGGAGG + Intronic
999586948 5:153099882-153099904 AAAAGTAAAATAAAGGTTGGAGG + Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000483012 5:161803439-161803461 CAAAATAAAAAAAATGTTGGTGG - Intergenic
1000697472 5:164405564-164405586 AAAAGGACACAGAAGTTTGGAGG + Intergenic
1000888139 5:166771434-166771456 AAAAATAAATAGAAGATTGGGGG - Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001682853 5:173571308-173571330 AAAACTAAAGAGAAGGTTGTAGG - Intergenic
1003084300 6:3049260-3049282 CAAAGTAGGCAGAAGGGAGGGGG - Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004726092 6:18312596-18312618 GAATGGAAACAGAGGGTTGGAGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008110233 6:47484119-47484141 CAAAATAAACAAAAGCTGGGAGG - Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010182642 6:73105903-73105925 GAAAATAATCAGAAGCTTGGGGG - Intronic
1010993783 6:82509952-82509974 CAAGGTCAACAGAAGGCTGTGGG - Intergenic
1011590001 6:88963095-88963117 GAAGGTAGACAGGAGGTTGGTGG - Intronic
1011848499 6:91596265-91596287 TAAACTCAACAGAAGGTTAGTGG + Intergenic
1011876072 6:91964122-91964144 CAAAGTAAATAAAAGGTTGTTGG + Intergenic
1012260571 6:97082994-97083016 GAAAGTACACAGTAGGTTGCGGG - Intronic
1013302752 6:108819426-108819448 CAAAGAAAACATAGGGTTAGAGG - Intergenic
1017124262 6:151051056-151051078 CCAAGTAAGTAGAAGATTGGAGG - Intronic
1017263350 6:152413762-152413784 CAAACTTAATAGAAGGTTGATGG - Intronic
1017999302 6:159564703-159564725 TGAAGTAAACAGAATCTTGGCGG + Intergenic
1018836554 6:167488631-167488653 CTAAGGAAACTGAAGCTTGGAGG - Intergenic
1020372643 7:7450712-7450734 AAAAGGAAACAGAATGTTTGTGG + Intronic
1021231493 7:18090775-18090797 CAAAGTGAACAGAAGGTTTATGG + Intronic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1023040510 7:36168757-36168779 CAAAAAAAAAAAAAGGTTGGGGG + Intronic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028161800 7:87494126-87494148 TAAAGTAAACAGCAGTGTGGAGG + Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029911118 7:104149047-104149069 AAAAGTAAATTTAAGGTTGGGGG + Intronic
1032418789 7:131761041-131761063 CACAGTCAACAGAAAGTTGAAGG + Intergenic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1035909709 8:3552545-3552567 CAAGATAAACATAAGGTGGGGGG + Intronic
1036428618 8:8669127-8669149 CAAAATGAACAGAGGGTTGGTGG - Intergenic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1038522182 8:28243182-28243204 CTAAGAAAAAAAAAGGTTGGGGG - Intergenic
1038553605 8:28490647-28490669 ACAGGTAAACAGAGGGTTGGAGG + Intergenic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1040076177 8:43233607-43233629 CAATGGAAAAAGAAGGTAGGAGG + Intergenic
1041170485 8:55137194-55137216 CAAAGTCAAAAGAAAGTTGGAGG + Intronic
1041442508 8:57912201-57912223 CAAAGCACACAGAAGCTTGGGGG + Intergenic
1041711665 8:60899917-60899939 GAAAGTAAACAGGAGGCTTGAGG - Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042767331 8:72337888-72337910 AAAATTAAGCAGAAGGTTGTGGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044172942 8:89079376-89079398 CAAAGTGATGAGAAAGTTGGTGG + Intergenic
1044355148 8:91213775-91213797 GAAAGTAAACAGAATGTTTTAGG + Intronic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047160832 8:122377416-122377438 CAAAGGAAACACATGGTAGGTGG + Intergenic
1047953200 8:129952720-129952742 CAAAGCAAACAGAAGGCTCATGG + Intronic
1048077683 8:131090866-131090888 CAACATTAACAGAAGTTTGGAGG + Intergenic
1048886992 8:138916646-138916668 CAAAGGAAACAAAAGTCTGGAGG + Intergenic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051521317 9:17992049-17992071 CAAAATAAACATCAGGTAGGTGG - Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052086243 9:24269723-24269745 CTAAGTAAACAAAATGTTAGTGG - Intergenic
1053753543 9:41279656-41279678 CAAAGTGAACAACAGGTCGGTGG - Intergenic
1054259066 9:62844019-62844041 CAAAGTGAACAACAGGTCGGTGG - Intergenic
1054332712 9:63776021-63776043 CAAAGTGAACAACAGGTCGGTGG + Intergenic
1054943659 9:70771557-70771579 AAAAGGAAACTGAAGGTGGGTGG + Intronic
1056620358 9:88207288-88207310 AGAAGTAAACAGAAGGCTGTGGG + Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1058566317 9:106289005-106289027 CAACGTAACAAGAAGGGTGGAGG - Intergenic
1059347661 9:113640857-113640879 AAAAGTAAACAAAACGTTTGTGG - Intergenic
1059742344 9:117164412-117164434 AAAAGTGAACAGAAGCCTGGAGG + Intronic
1060089519 9:120730814-120730836 CTAAGCAAACAGCAGGTGGGCGG + Intergenic
1202799716 9_KI270719v1_random:164332-164354 CAAAGTGAACAACAGGTCGGTGG + Intergenic
1188896294 X:35672516-35672538 CAAAGTAGACAGTAGTTTAGGGG - Intergenic
1190800342 X:53782690-53782712 CAAAGGACACAGGAGTTTGGAGG + Intergenic
1192040750 X:67618762-67618784 CAAAGGAGACAGATGGCTGGGGG + Intronic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1194369583 X:93055825-93055847 CAATGTAACCACAGGGTTGGGGG - Intergenic
1194791518 X:98156852-98156874 CAAAGCAATCATAAGGTGGGGGG + Intergenic
1195318434 X:103700987-103701009 CAAAGAAAAAAGAAACTTGGTGG + Intergenic
1195387209 X:104324568-104324590 GGAAGTAACCAGGAGGTTGGTGG - Intergenic
1195611217 X:106869297-106869319 CACAGTAAAAAGAACATTGGGGG - Intronic
1197411836 X:126124959-126124981 AGAAGTAAAGAGAAGGTTTGAGG - Intergenic
1198314804 X:135454675-135454697 AAAAGAAAACAGAAAGTAGGGGG + Intergenic
1198922030 X:141739850-141739872 CAAAGTAGAGAAAAGGTTGCTGG + Intergenic
1200421286 Y:2971487-2971509 CAAAGGATACAGCAGGTAGGGGG - Intronic
1200677775 Y:6172037-6172059 CAATGTAACCACAGGGTTGGGGG - Intergenic