ID: 996383121

View in Genome Browser
Species Human (GRCh38)
Location 5:122882534-122882556
Sequence CAGAACAAAGAGATGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 458}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996383121_996383127 6 Left 996383121 5:122882534-122882556 CCTGCCCTCATCTCTTTGTTCTG 0: 1
1: 0
2: 4
3: 42
4: 458
Right 996383127 5:122882563-122882585 GGACCCACTGTGAATGCTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 108
996383121_996383126 5 Left 996383121 5:122882534-122882556 CCTGCCCTCATCTCTTTGTTCTG 0: 1
1: 0
2: 4
3: 42
4: 458
Right 996383126 5:122882562-122882584 TGGACCCACTGTGAATGCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 146
996383121_996383125 4 Left 996383121 5:122882534-122882556 CCTGCCCTCATCTCTTTGTTCTG 0: 1
1: 0
2: 4
3: 42
4: 458
Right 996383125 5:122882561-122882583 CTGGACCCACTGTGAATGCTTGG 0: 1
1: 0
2: 1
3: 19
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996383121 Original CRISPR CAGAACAAAGAGATGAGGGC AGG (reversed) Intronic
900750898 1:4396758-4396780 CAGAACAAAGGGCTGAGGCATGG + Intergenic
900789894 1:4672905-4672927 GAGGAGATAGAGATGAGGGCAGG + Intronic
900828449 1:4945809-4945831 CAGAACAAAGCAAGGAGGCCTGG - Intergenic
903885523 1:26538900-26538922 CTGCACAAAGTGATGAGGTCCGG - Intronic
904062263 1:27720981-27721003 TATAAAAAAGACATGAGGGCTGG - Intergenic
904076525 1:27847005-27847027 CTGCAAAAAGAGAAGAGGGCAGG - Intronic
904996948 1:34638721-34638743 CAGAAAATAGAGATTAGGGTGGG + Intergenic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
906048238 1:42849638-42849660 ATGAACAAAGGGATGAGGGAGGG - Exonic
906375252 1:45291437-45291459 CAGAACTATGATATGATGGCTGG - Intronic
907466093 1:54638147-54638169 CAGAAAAAATAGATTTGGGCTGG + Exonic
909475023 1:76072988-76073010 CAGAGCAAAGGGGTGAGGGTGGG - Intergenic
910792333 1:91064411-91064433 CTGTACAAAATGATGAGGGCAGG + Intergenic
912551755 1:110489560-110489582 CAGTACAATGAGGTGAGGTCAGG + Intergenic
912811875 1:112801181-112801203 CATAAAAAAGAGGTGAGGGCCGG + Intergenic
913184828 1:116360863-116360885 GAGAACAAAGAGAATAGGACGGG + Intergenic
913537223 1:119784671-119784693 CAGCCAACAGAGATGAGGGCTGG - Intergenic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914761781 1:150605052-150605074 CAAAAAAAAGAGATGAGGTGAGG - Intronic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915045349 1:153008854-153008876 CAGGAGAAAGAGTAGAGGGCTGG - Intergenic
915554932 1:156656172-156656194 CAGGACAGAGAGACCAGGGCTGG + Intronic
915562983 1:156698372-156698394 CAAAAGAAACAGATGAGGCCGGG + Intergenic
915626482 1:157117265-157117287 CAGCACAAACAGATGATGGCAGG - Intergenic
916299368 1:163256816-163256838 AAGAACACAGTGATGAGGGTGGG + Intronic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
916449859 1:164910170-164910192 CAGAACAAAGGGATGAAGGAAGG - Intergenic
917114085 1:171584436-171584458 CAGAATAAAGATTTGAGGCCTGG - Exonic
917117250 1:171615024-171615046 CAGATCAAAGAAATCAGGGTGGG + Intergenic
918824458 1:189305132-189305154 CAGAACAAAGATGTGAGAGCTGG - Intergenic
920372297 1:205486788-205486810 GAGGACAGAGAGTTGAGGGCAGG - Intergenic
921046020 1:211478716-211478738 CAGAACCAGGAGATGAGGATGGG + Exonic
921640183 1:217543831-217543853 CAGAACAAACAAAGAAGGGCAGG + Intronic
922857649 1:228788820-228788842 CAGAGCAAAAGGATGAGAGCGGG - Intergenic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
1062880562 10:974636-974658 CAGAACACAGAAATGAGGCCAGG + Intergenic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063863856 10:10342572-10342594 CAGGTCAATGAGATAAGGGCTGG + Intergenic
1064708298 10:18095521-18095543 CAAAAGAAAGAGAATAGGGCCGG - Intergenic
1065472401 10:26095595-26095617 CAGAAGGAAGACATGAGGGAAGG + Intronic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1065825031 10:29562897-29562919 ACGGAGAAAGAGATGAGGGCAGG + Intronic
1065918525 10:30371512-30371534 CAGAACAGAGAGACCTGGGCTGG + Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1067151654 10:43740060-43740082 AACAAAAAAGAGATGAGGTCAGG - Intergenic
1067285455 10:44904509-44904531 AAATACAAAGAGATGAGTGCTGG + Intergenic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1070209856 10:74305493-74305515 CAGAAAAAAGAGCTAAGGGAGGG - Intronic
1070278202 10:75028605-75028627 CAAAACAAAGAGAGGAAGACCGG + Exonic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1072494277 10:95940142-95940164 AAGAAGAAAGAGAAGAGGGGAGG + Intergenic
1072865153 10:99051467-99051489 CAGGACACAGAGTTCAGGGCAGG + Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073581230 10:104667365-104667387 CAGGATCAAGAGAGGAGGGCAGG - Intronic
1074596353 10:114871456-114871478 CAGAACAAAGGGAAGAGGCTGGG - Intronic
1074702012 10:116100805-116100827 CAGAGCAAAGAACCGAGGGCCGG + Intronic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075626425 10:123967412-123967434 CAGAGCCAAGAGTTGAGGCCAGG + Intergenic
1076046282 10:127296703-127296725 CAGGACAATGGGATGAGGGAAGG + Intronic
1076304643 10:129456356-129456378 CAGCACAAAGACAAGAGAGCAGG - Intergenic
1076644492 10:131943281-131943303 CTCAACACAGAGATGGGGGCGGG + Intronic
1077180423 11:1209953-1209975 CTGAACCAAGTGATGAAGGCTGG - Intergenic
1078329867 11:10410344-10410366 CAGAACAAGGAGGTAAGGGTAGG + Intronic
1078377409 11:10808068-10808090 GAGAACAAAGAGCTGGGCGCCGG - Intronic
1079422355 11:20305500-20305522 CAGGACAAAGATATGATGTCTGG - Intergenic
1081487365 11:43542016-43542038 CATTACAAAGAAATGTGGGCTGG + Intergenic
1082037189 11:47654476-47654498 AAGAACAAAGGAAAGAGGGCGGG + Intergenic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1083672434 11:64306757-64306779 CAGAATACCCAGATGAGGGCAGG + Intronic
1084369976 11:68734904-68734926 CAGAGCAGTGAGGTGAGGGCAGG - Intronic
1085210978 11:74778033-74778055 CAGGAGAAAGAGAACAGGGCTGG - Intronic
1085640863 11:78191830-78191852 AAAAAAAAAAAGATGAGGGCCGG - Intronic
1086347557 11:85912626-85912648 CTGATCACAGAGAGGAGGGCTGG - Intronic
1087127387 11:94641319-94641341 CTGAACGAAGGGATGTGGGCAGG - Intergenic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1090416555 11:126544436-126544458 CAAAACAAAGAGAAGAGAACTGG - Intronic
1090683722 11:129091019-129091041 CAGAATAAAAAGATAAGGGAGGG + Intronic
1090840466 11:130483286-130483308 CTGAACAAAGACATGAGGCAGGG + Intergenic
1090937838 11:131360979-131361001 CTGAACATTGAGAAGAGGGCAGG + Intergenic
1092618856 12:10240354-10240376 TAGAAAATAGAAATGAGGGCTGG - Intergenic
1093153576 12:15653383-15653405 GAGCATATAGAGATGAGGGCTGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093546805 12:20358380-20358402 CAGCACACAGAGATGTGAGCAGG - Intergenic
1094332484 12:29310111-29310133 TAGAAGAAAGAGTTGAAGGCAGG - Intronic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1095311893 12:40708447-40708469 CAGCAAAAAGAGATTATGGCTGG - Intronic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095641668 12:44493047-44493069 TAGAAGAAAGAGATGAGCTCAGG - Intergenic
1095745720 12:45656404-45656426 CAGAAGAAAGAGATGATGCAAGG + Intergenic
1095790021 12:46156516-46156538 CAGAACAAAGAGAATAAGGTGGG - Intergenic
1096058251 12:48673650-48673672 CAAAATTAAGAGATGAGGCCAGG + Intronic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1096747628 12:53738879-53738901 CAGAAAGAAGAGAGGAGAGCAGG + Intergenic
1097630295 12:62052495-62052517 GAGCACAAAGAGAAGAGGGTTGG - Intronic
1097987544 12:65799852-65799874 GAGAATAAAGAGATGAGACCTGG - Intergenic
1098219215 12:68250997-68251019 CAGAACAATGAGAAAAGAGCTGG - Intronic
1098346499 12:69509883-69509905 AATAACAAAGGAATGAGGGCTGG - Intronic
1099891315 12:88592236-88592258 AAAAACAAATAGGTGAGGGCGGG - Intergenic
1100411842 12:94326538-94326560 GAGAACAAAGAAATGATTGCTGG + Intronic
1100797577 12:98198485-98198507 CAGAACAAACAGGTGGGGGTAGG - Intergenic
1101006865 12:100409872-100409894 GTAAGCAAAGAGATGAGGGCTGG + Intronic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1102322229 12:111946441-111946463 CAAAACAAAGAGATGGGCTCTGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102909720 12:116703636-116703658 CAGAATAAAGACATGGGGGTGGG + Intergenic
1102975262 12:117202451-117202473 CAGAAATAAGAGAGGAGGGTGGG + Intergenic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104503617 12:129310032-129310054 CAGAAAATCTAGATGAGGGCTGG + Intronic
1106341997 13:28838688-28838710 CAGAAAGAAAAGCTGAGGGCTGG - Intronic
1107750889 13:43565234-43565256 AAGAACAAAGACATTATGGCTGG + Intronic
1107859024 13:44643160-44643182 AAAAACAAAAAGATGAGGCCAGG - Intergenic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108088381 13:46819169-46819191 GAGCTCAGAGAGATGAGGGCTGG + Intergenic
1108822328 13:54368627-54368649 AAGAACAAAGAAATGAGAGAAGG + Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1114255729 14:20999922-20999944 CAGGACAAAGGGAAGAGAGCGGG + Intronic
1114324079 14:21571522-21571544 GAGAAAGAAGAAATGAGGGCTGG + Intergenic
1114495681 14:23130215-23130237 CAGGAGAAAAGGATGAGGGCAGG - Intronic
1115437373 14:33390567-33390589 CTGTAGAGAGAGATGAGGGCAGG + Intronic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1117084453 14:52185040-52185062 CAGGACAAAGGGAGGAGGACAGG + Intergenic
1117362180 14:54986757-54986779 CTGAAGAAAGACATGAGGGGAGG + Intronic
1117365753 14:55025868-55025890 CAGTATAAAGAGATGAGTGGTGG - Intronic
1117782499 14:59248775-59248797 CAAAACAAAAAAATGAGGGATGG - Intronic
1117989748 14:61421940-61421962 AGGAAGAAAGAGATTAGGGCAGG + Intronic
1119687291 14:76643045-76643067 CAGAAGCCAGAGAGGAGGGCAGG - Intergenic
1119720547 14:76887229-76887251 CAGAACACAGAAATGAAGCCAGG + Intergenic
1119977427 14:79040719-79040741 CAAAAGAAACTGATGAGGGCTGG + Intronic
1121077708 14:91083224-91083246 AAGAACAAAGAGAGAAGGCCGGG + Intronic
1121369567 14:93344808-93344830 GAGAACAAGGAGATGAGGTTAGG + Intronic
1122051696 14:99065353-99065375 CAGAACAACCAGGTGGGGGCGGG - Intergenic
1122212640 14:100182588-100182610 CAGACACAAGAGATGAGGGTTGG + Intergenic
1124169077 15:27356241-27356263 AAAAACAAAGATATGAGGGAAGG + Intronic
1125341838 15:38683124-38683146 CAGCACAGACAGATGAGGGATGG - Intergenic
1125898775 15:43326181-43326203 CAGAACACTGTGATGAGGCCAGG - Exonic
1125952888 15:43768636-43768658 TGGAACAAAGAAATGAGGACAGG - Intronic
1126201534 15:45992200-45992222 CATAGCACAGAGCTGAGGGCAGG + Intergenic
1126466617 15:48966354-48966376 CAGATCAATGAGATCAGGGCTGG + Intergenic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1128616452 15:69114231-69114253 AAGAACAAAGGTGTGAGGGCAGG - Intergenic
1129051623 15:72785992-72786014 CTGAACAAAGAGGAAAGGGCTGG + Intergenic
1129358834 15:75011794-75011816 CAGGACAAAGAGGTGTGGGCAGG + Exonic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1130016142 15:80187913-80187935 GACAACAAAGAGGTGAGGACTGG + Intergenic
1130778832 15:87013295-87013317 AATAACAAAGAGACCAGGGCTGG - Intronic
1131184982 15:90266182-90266204 GCGATCAAAGAGAAGAGGGCTGG + Intronic
1132727851 16:1346499-1346521 CAGAACGATGAGGTGAGTGCCGG + Exonic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133449314 16:5890400-5890422 CAGAACTAAGAAGTGAAGGCTGG + Intergenic
1133531942 16:6663482-6663504 CAGAACAAAGACATGGGAGAAGG + Intronic
1133704617 16:8341828-8341850 AATAATAAAAAGATGAGGGCAGG - Intergenic
1134116659 16:11553752-11553774 CAGGACAAAGAGAGGAACGCAGG + Intronic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1135401149 16:22166873-22166895 GAGGAAGAAGAGATGAGGGCAGG - Intronic
1135877506 16:26216837-26216859 CAGATTAAATAGCTGAGGGCTGG + Intergenic
1135910084 16:26552349-26552371 CAGACACAAGAGATGAGGGTTGG + Intergenic
1137948142 16:52755669-52755691 CACAAGAAAAAGTTGAGGGCTGG - Intergenic
1138293843 16:55870241-55870263 CAGAAAGAAGAGAGGAGGGGAGG + Intronic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1139656925 16:68393592-68393614 CAGAACTCAGAGTTGAGGTCTGG + Intronic
1140725443 16:77807421-77807443 CTGAACAAAGACATGGGGACTGG - Intronic
1141841559 16:86577164-86577186 CATGTCAAAGAGATGAGGGAAGG - Intronic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1143358767 17:6350820-6350842 AAGAAGTAAGAGATGAGGTCAGG - Intergenic
1143537993 17:7552874-7552896 GAGAACAGAGAAATGATGGCTGG + Intronic
1143767346 17:9146370-9146392 GAGAACAATGAGATGAGCTCAGG - Intronic
1143771294 17:9170636-9170658 CAGCACAGAGAGGTGGGGGCGGG + Intronic
1143878457 17:10011585-10011607 CAGTACAAAGTGGTGAGGGTAGG - Intronic
1144124875 17:12193791-12193813 AAGTCCAAAGAGATCAGGGCTGG - Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147658727 17:42105641-42105663 CAGCACAGAGAGGTGGGGGCAGG - Intronic
1147914017 17:43876063-43876085 CACACCAACGAGATGGGGGCAGG + Intronic
1148067696 17:44884594-44884616 CAAAATAAAGAGTTGAGGGCCGG + Intronic
1148610525 17:48961660-48961682 GGGAACAAAGAGGTGGGGGCGGG + Intronic
1148646127 17:49220388-49220410 CAGATCCAAGAGAGGTGGGCTGG - Intronic
1150558751 17:66276911-66276933 CAGTAAAGAGAAATGAGGGCTGG + Intergenic
1151591372 17:75047039-75047061 CAGCCAATAGAGATGAGGGCTGG + Intronic
1151761939 17:76109342-76109364 AAAAAAAAAGAGGTGAGGGCCGG + Intronic
1151837205 17:76589867-76589889 GAGAACAAAGAGTTGCAGGCTGG - Intergenic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1153776118 18:8455751-8455773 AAGGACAAAGAGAAGAGGGCAGG - Intergenic
1153832077 18:8932659-8932681 CTGAACAACCAGATGAGGCCAGG - Intergenic
1154033245 18:10772507-10772529 CAGAACACAGAGGAGAGGACTGG - Intronic
1155858719 18:30868814-30868836 CATAACAAAGAGGAGAGGCCGGG + Intergenic
1155878656 18:31117464-31117486 GAGAACAAAGAGAGGAAGGGAGG - Intergenic
1156513257 18:37659365-37659387 AAGGACAAAGAGATGAGAGAGGG - Intergenic
1156935338 18:42699003-42699025 CAGAACAAAAAGTTCAGTGCTGG + Intergenic
1156944675 18:42814602-42814624 GAGGACCAACAGATGAGGGCAGG - Intronic
1157354745 18:46922390-46922412 CAGAATAAAAAGTTGAGGCCGGG - Intronic
1157471221 18:47990645-47990667 GAGAAGAAAGAGAGGAGGCCAGG + Intergenic
1157601023 18:48893343-48893365 CGGAACAGAGCCATGAGGGCAGG - Intergenic
1158431068 18:57388056-57388078 CAGAAGATCTAGATGAGGGCAGG + Intergenic
1159153857 18:64556520-64556542 CAGAAAAGAGACATGTGGGCTGG - Intergenic
1160234041 18:77071513-77071535 CAGAACAGAAAGATGAGGAAGGG + Intronic
1160379341 18:78439642-78439664 CAGGACAAAGGGAAGAGGGTGGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1162231050 19:9267181-9267203 AGGCACAAAGAGAAGAGGGCAGG - Intergenic
1163473494 19:17511688-17511710 GAGAACACCGAGATGAGGCCCGG - Exonic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165459056 19:35933553-35933575 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165459132 19:35934011-35934033 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165492805 19:36134900-36134922 CAGGGCGAAGAGATGAGGGCAGG + Intergenic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1166242102 19:41501524-41501546 GAGAACAAAGAAAAGAGGGATGG + Intergenic
1166394791 19:42431274-42431296 CAGACCAGTGAGAGGAGGGCAGG - Intronic
1166809039 19:45504731-45504753 AACAAAAAAAAGATGAGGGCAGG - Intergenic
1166865253 19:45832137-45832159 CAAAAAAAACAGCTGAGGGCTGG - Intronic
1167482967 19:49744520-49744542 CAGAGCAGAGAGGGGAGGGCAGG - Intronic
1168050581 19:53826713-53826735 CAGACCAAACAGAGGAGGCCTGG + Intergenic
1168605080 19:57752163-57752185 CAAAACAAACAAATGAGGCCGGG - Intronic
925598725 2:5586639-5586661 CAGAAATAAGACATGAGGGGAGG + Intergenic
927137603 2:20108336-20108358 AAGAAGAAAAAGAAGAGGGCCGG + Intergenic
928096210 2:28406762-28406784 CAGAGCAAAGCCCTGAGGGCTGG - Intronic
928368834 2:30723962-30723984 CAGAAGAAAGAGTTTAGGGAGGG - Intronic
928677978 2:33668894-33668916 GTCAAAAAAGAGATGAGGGCTGG + Intergenic
928977776 2:37106746-37106768 TAGAACAAAGAGATGAGGCTGGG + Exonic
929010923 2:37443380-37443402 CAGGTCACAGAGATGAGGGGTGG + Intergenic
929123141 2:38499874-38499896 CAGTACACAGAGATGTGGGGAGG + Intergenic
929431160 2:41887842-41887864 CTGGACAATGAGATGAGGGGAGG + Intergenic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932174571 2:69587906-69587928 AAGAAAAAAGAAATGAGGCCTGG - Intronic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
935163386 2:100548582-100548604 CAGAAAAAAGGGATGAGGAAGGG - Intergenic
936713199 2:115156923-115156945 CAGCTCAAAGAGATGATGGAAGG + Intronic
936771170 2:115915174-115915196 CAAAACAAAGAGATGGGCTCTGG - Intergenic
938012256 2:127838249-127838271 AACAACAAAAAGATGTGGGCTGG - Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939968381 2:148633436-148633458 CAGAGGGAAGAGATGAGAGCTGG + Intergenic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
942331988 2:174836095-174836117 AAGGACAAAGAGATTAGGGTGGG - Intronic
942867075 2:180689792-180689814 CAGAAGGAAGAGATAATGGCAGG - Intergenic
943699460 2:190973956-190973978 CTCAACAAAGAGAGGAAGGCAGG - Intronic
945847046 2:214958073-214958095 TAGTCCACAGAGATGAGGGCCGG + Intronic
946069732 2:217023678-217023700 TAGAACAAAAAGATGAAGGAAGG - Intergenic
946295918 2:218783370-218783392 CAGAACACAGAAATGAGGCAGGG + Intronic
946809784 2:223511381-223511403 AAGGAAGAAGAGATGAGGGCTGG + Intergenic
947154610 2:227149420-227149442 CAGAAAAGAGAGATGAGGAAGGG - Intronic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
947502278 2:230679990-230680012 CAGAACACAGAGATCAGCACAGG + Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948672204 2:239575742-239575764 CAGGACACAGAGATGAAGGCTGG - Intergenic
948704579 2:239780891-239780913 CAGAACCAAGAGATGAAGAGGGG - Intronic
949011153 2:241679294-241679316 CAGCACAATGAGCTGAGGGAAGG + Intronic
1168818483 20:757172-757194 CTGAAGAATGAGATCAGGGCTGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169449530 20:5699741-5699763 CATAACAAAGAAATGAAGACAGG - Intergenic
1169634606 20:7674943-7674965 GAGAAAAAAGAGATCAGGTCTGG + Intergenic
1170197001 20:13699540-13699562 CAGGAAACAGAGATGAGGGGAGG + Intergenic
1170316669 20:15049298-15049320 AAGAAGAAAGAGAAGAGGGAGGG + Intronic
1170890592 20:20372103-20372125 AAGAACAAAAAGCTCAGGGCTGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171428730 20:25065265-25065287 CAGGACAAAGCCATGAGGGCAGG - Intergenic
1171971745 20:31569248-31569270 CAGACCAGACAGATGGGGGCTGG + Exonic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172760708 20:37319292-37319314 CAGAACAAAAAGAGGAAGGTTGG - Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173947029 20:46959780-46959802 CAGAGAAAAGAGATGAGCCCTGG - Intronic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1174506456 20:51020816-51020838 AAGAACAAAGAGATGTGTGCTGG - Intronic
1175266235 20:57705062-57705084 CAACCCAAAGAGAAGAGGGCAGG + Intronic
1175671364 20:60905584-60905606 AAGAACAAAGCGATGTGTGCTGG + Intergenic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176387632 21:6146802-6146824 CAGAACAAAAGGCTGAGGGAGGG - Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1178014159 21:28323779-28323801 CAGAACAAAGAGAAAAGAGAGGG - Intergenic
1179138209 21:38699186-38699208 CAGAACAAAGAGAGGAGCACTGG + Intergenic
1179606253 21:42517391-42517413 CAGATAGAAGAGATGAGGGGCGG + Intronic
1179735840 21:43391446-43391468 CAGAACAAAAGGCTGAGGGAGGG + Intergenic
1180696014 22:17752022-17752044 GAGAACAAAGTGGTGAGGGGCGG - Intronic
1181427198 22:22851384-22851406 CAGAAAGAAGAGATCAGGGGTGG - Intronic
1182964989 22:34512567-34512589 CAAACCCAAGAGATGGGGGCAGG + Intergenic
1183950196 22:41348431-41348453 CAGAACAAAAAGCTGAGGCTTGG + Intronic
949337428 3:2991260-2991282 CAGTACAAAAAGAGGAAGGCAGG + Intronic
949469864 3:4383080-4383102 AAAAAAAAAGAGATCAGGGCCGG + Intronic
949507060 3:4738300-4738322 CAAATAAAAGAAATGAGGGCAGG + Intronic
950218654 3:11177994-11178016 CAGATAACAGAGATGATGGCAGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951710583 3:25581938-25581960 CTGAACTAAGACAGGAGGGCAGG + Intronic
952304491 3:32133974-32133996 CAGAACGAAGGCATCAGGGCTGG - Intronic
952628804 3:35440059-35440081 CATAAGAAACTGATGAGGGCTGG - Intergenic
952705862 3:36377420-36377442 CAGAACAAAGAAATGAGAGAAGG + Intergenic
953687749 3:45091439-45091461 CAGGACACAGAGGTGAGGGATGG + Exonic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
953746049 3:45574889-45574911 CAGAAAAAAGACATCATGGCTGG + Intronic
954472432 3:50708966-50708988 CAGAACAGAGAGATGATGGTGGG - Intronic
954624319 3:52014312-52014334 AAGAACAGAGAGATGAGAGCAGG + Intergenic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
956197233 3:66665195-66665217 TAGAACACAGACATGAAGGCTGG + Intergenic
956599817 3:71008897-71008919 CAGAAAAAAGAGAGGTGGGGGGG - Intronic
958440739 3:94153416-94153438 CAGAGCAAAGTAATGAGGGTTGG + Intergenic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
959909622 3:111748816-111748838 AAGAAAAAAGAGGTGATGGCTGG - Intronic
960030353 3:113048073-113048095 CAGAATTCAGAGATGAGGGCTGG - Intergenic
961239090 3:125394737-125394759 GAGAACAAATAGATCTGGGCTGG + Intergenic
961326322 3:126111514-126111536 CAGAAACATGAGCTGAGGGCAGG + Intronic
961692356 3:128679287-128679309 GAAAACAAAGAGAAGAGGGTTGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963134261 3:141886296-141886318 CAGAACGAAGAGATTGGGGAAGG - Intronic
963170903 3:142250426-142250448 TAGAACAGACAGAAGAGGGCCGG + Intergenic
964259268 3:154816684-154816706 CAGAATACAGAGATGAGACCTGG - Intergenic
964343488 3:155732389-155732411 TAGAACTAATAGATGAGGCCGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967605686 3:191442921-191442943 CAGGACAATTAGATGATGGCTGG + Intergenic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
967731924 3:192915148-192915170 CAGAACAAAGCCAAGAGGACTGG + Intronic
969302235 4:6303904-6303926 CACAGCAAAGAGGTGAGGCCTGG - Intergenic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969656531 4:8501897-8501919 CTCAACAGAGAGATGTGGGCAGG - Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971435137 4:26613419-26613441 CAGAAAAGAGAGATGAGGAAAGG + Intronic
971469673 4:27008872-27008894 CAGAATAAAGGGAAGAGGTCAGG - Exonic
971713286 4:30144784-30144806 CAAAAGATAGAGAAGAGGGCCGG + Intergenic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
972322168 4:37982062-37982084 TAGAAGAAAGAGATGATGGAAGG - Intronic
975431364 4:74295188-74295210 GAGAAGAAAGAGAGGAGGCCGGG - Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976348361 4:84031089-84031111 CTAAACAAAGAGACAAGGGCAGG + Intergenic
978837891 4:113175492-113175514 GTGAACAAAGAGAGGAGTGCTGG - Intronic
980001217 4:127490685-127490707 AAGAACAAAGAGAATAGGGGAGG + Intergenic
980622215 4:135322574-135322596 CAGAACCAACAGATGTTGGCAGG + Intergenic
981467269 4:145087749-145087771 AACAATAAAGAGATGAGGCCAGG + Intronic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983120533 4:163878531-163878553 AAGAACAAAGAGATGAGTCAGGG - Intronic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984968493 4:185164597-185164619 CAGAAAAGAGAGATGAGGAAGGG - Intronic
985062229 4:186090999-186091021 AAGAACAATTTGATGAGGGCGGG + Intergenic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986485592 5:8232978-8233000 CAGAAGGAAGAGGAGAGGGCAGG + Intergenic
986725075 5:10589270-10589292 AAGACCAAAGAGAAGAGGGGAGG - Intronic
986833336 5:11606644-11606666 CTGAATGAAGAGGTGAGGGCTGG + Intronic
986984627 5:13486293-13486315 CTGAGCAAAGAGATGATGGGTGG + Intergenic
988117583 5:26917500-26917522 CTGAAGAAATAGGTGAGGGCAGG - Intronic
988156680 5:27461879-27461901 CAGAACAAATCAATGAGGACAGG + Intergenic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992657945 5:78929103-78929125 CAGAACAGAAAGATGAAGTCTGG - Intronic
993339682 5:86708004-86708026 AAAAACATAGAGAGGAGGGCTGG + Intergenic
993528635 5:88998636-88998658 CAGGACAAAGACCTGAAGGCGGG + Intergenic
994046676 5:95318042-95318064 CAGAGCAAATATATGATGGCAGG - Intergenic
995525945 5:113050701-113050723 CAGAACAAACATATAAGTGCAGG + Intronic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996547086 5:124691276-124691298 CAAAAAAAAAAGGTGAGGGCTGG + Intronic
996555149 5:124770554-124770576 AAGAACAAAATGATGAGGCCAGG - Intergenic
997224948 5:132202892-132202914 CAGAACAAAGAAAGAAAGGCGGG - Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999891290 5:155981111-155981133 CAGCCCACTGAGATGAGGGCTGG + Intronic
999940862 5:156541370-156541392 AGGAACAAAGAGATCAGGGAGGG + Intronic
999954672 5:156687433-156687455 CAGAACAAAAAGAAAAGGGGAGG + Intronic
1000017278 5:157289167-157289189 CAGGAGAAAGAGATCAGGACTGG - Intronic
1000906892 5:166975171-166975193 CAGAACAGCGAGATGAATGCTGG + Intergenic
1001478334 5:172066787-172066809 AAAAACAAAGAGAAGAGCGCAGG + Intronic
1001818426 5:174690755-174690777 CAAAACAAGGGGATGAGGGTGGG - Intergenic
1003140421 6:3466951-3466973 TAGAACAAAGAAAGCAGGGCTGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003153991 6:3575820-3575842 CAGAAGGGAGAGATGACGGCGGG - Intergenic
1003221610 6:4165430-4165452 CAGAACAAATAGAAGAGAACTGG - Intergenic
1003727906 6:8786874-8786896 CAGAGAGAAGAGATGAGGGTAGG + Intergenic
1004353761 6:14913634-14913656 CAGAACGAAGGAATAAGGGCTGG - Intergenic
1004902726 6:20209009-20209031 CAAAACAAAGTGAGGAGGACAGG + Intronic
1004948996 6:20647039-20647061 CAAAACAAATAAATAAGGGCCGG - Intronic
1005265838 6:24111353-24111375 CAGAACAAAGACATTAGGTCAGG - Intergenic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006392933 6:33769491-33769513 CAGAGGCAAGGGATGAGGGCAGG - Intergenic
1007134499 6:39508015-39508037 AAGAAAAAAGAGAAGAGGGAGGG - Intronic
1007930824 6:45689049-45689071 CAGAAGAAAGACAGGAGGACTGG + Intergenic
1008964253 6:57298459-57298481 GAGAACAAAGAGATGAGGAGTGG + Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1010023555 6:71189660-71189682 AAGAAAAAAGAGATAAGGGCTGG + Intergenic
1010395082 6:75382373-75382395 CAGAACAAAGCTGTGAGTGCAGG - Intronic
1010976974 6:82326141-82326163 GAGAACAAAGAGAACAGGGTGGG - Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1011621661 6:89249320-89249342 TAGAAGAAAGAGATGAGGAGAGG - Intergenic
1012454507 6:99389815-99389837 CAAAACTATGAGATTAGGGCCGG + Intronic
1013914121 6:115313695-115313717 CAGAATAAAGAGATTTGAGCTGG + Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1020913636 7:14165043-14165065 CAGAAAATAGAAATGAGGGCTGG - Intronic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1022032806 7:26507561-26507583 CAGAACAAATATAGGAGAGCAGG + Intergenic
1022630057 7:32076342-32076364 CAGAAAAATGACATCAGGGCTGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023280968 7:38569121-38569143 CAGCAAAAATAGATGAGGGTTGG - Intronic
1023396336 7:39754924-39754946 CAGAACACAGTGCTGAGAGCAGG + Intergenic
1023877018 7:44292067-44292089 CAGAAGGCAGAGATTAGGGCTGG + Intronic
1024205483 7:47156020-47156042 CACAGGAAAGAGATGAAGGCTGG + Intergenic
1025946529 7:66109051-66109073 CAGGACCAAGAGACGAGGGGAGG - Intronic
1026302799 7:69112495-69112517 TAGCACAAAGAGATGAGGAAAGG + Intergenic
1026367450 7:69662911-69662933 TAGAACTAACAGAAGAGGGCTGG - Intronic
1026553179 7:71385245-71385267 CAGACCCAAGAGACAAGGGCTGG + Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1028366131 7:90034900-90034922 GAGAAGAAAGAACTGAGGGCTGG - Intergenic
1029204906 7:98863778-98863800 AAGAAAAAAGAGAGGAGGGAGGG - Intronic
1029334816 7:99889616-99889638 CAGAAGGAAGAGAGGAGGGAAGG + Intronic
1029469296 7:100744011-100744033 AAGAACAAAGAGATATAGGCTGG - Intronic
1029710370 7:102295925-102295947 CTGAACAATGAGTTGGGGGCAGG - Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030205007 7:106944200-106944222 CAGAGCAAAGGGAGAAGGGCAGG - Intergenic
1032616703 7:133480364-133480386 AAGCAAAAAGAGATGAGGCCAGG + Intronic
1033360583 7:140636362-140636384 CAGAAGGAACAGAGGAGGGCTGG + Intronic
1033672524 7:143506567-143506589 CAGAGCAAATAAATGAGAGCTGG + Intergenic
1033733311 7:144198860-144198882 AAGAACAAAGTGATAGGGGCTGG + Intergenic
1033749738 7:144352113-144352135 AAGAACAAAGTGATAGGGGCTGG - Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035391868 7:158509494-158509516 TAGAAAGAAGAGATGAGGACTGG - Intronic
1035489532 7:159260965-159260987 CAGAACAAAGGGCTGAGGAAGGG + Intergenic
1036371950 8:8169670-8169692 CGGGACACAGAGATGAGGTCAGG - Intergenic
1036709112 8:11067026-11067048 CAGAAACAAGACCTGAGGGCAGG + Intronic
1036878954 8:12495973-12495995 CGGGACACAGAGATGAGGTCAGG + Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037005827 8:13778510-13778532 GAGAACAAAGAGATAATGGCAGG - Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1040063582 8:43125713-43125735 CAGACCACAGAAATGAGGTCTGG + Intergenic
1040994847 8:53391132-53391154 CAGCTCACATAGATGAGGGCAGG - Intergenic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1042525449 8:69759941-69759963 CAAAATTGAGAGATGAGGGCCGG - Intronic
1042777455 8:72449224-72449246 AAGAATAAGGAGATGAGAGCAGG - Intergenic
1043364016 8:79510485-79510507 CAGATCCAAGAGATGGTGGCTGG + Intergenic
1043667521 8:82835309-82835331 GAGAAAAAAGAGTTGAGAGCAGG - Intergenic
1044661995 8:94600636-94600658 CAGAAGAAAGCGATGAGGCCGGG + Intergenic
1045067930 8:98468812-98468834 CAGAAAATAAAGATGAGAGCCGG + Intronic
1045084273 8:98664149-98664171 CAGTAGAAAGAAATGGGGGCAGG - Intronic
1045351268 8:101342322-101342344 CAGATCAAAGAGATAATGGATGG + Intergenic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047270384 8:123352158-123352180 CAGAGCAAGGAGGTGAGGGGAGG - Intronic
1047305228 8:123647531-123647553 AAGACCAAAGAGAAGAGAGCAGG + Intronic
1048325269 8:133434304-133434326 CTGAGAGAAGAGATGAGGGCAGG - Intergenic
1049829636 8:144692223-144692245 CAGAATAGCCAGATGAGGGCAGG - Intergenic
1049971002 9:821946-821968 CAGCACAATGAGATGATGGCAGG + Intergenic
1049986261 9:954539-954561 AAGATCCAAGAGATGAGGGAGGG + Intronic
1050413100 9:5386657-5386679 CAGAAGGAAAAGATGAAGGCTGG - Intronic
1051016467 9:12481648-12481670 CAGAACAAAGACAGGTCGGCAGG + Intergenic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1052857382 9:33415687-33415709 CACAACAAAGGCATGTGGGCTGG - Intergenic
1053366372 9:37525190-37525212 CAAAACAAAGAGGTGAGCCCAGG + Intronic
1053397608 9:37788360-37788382 CTTAACAAAGAGATGACAGCAGG - Intronic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1054718376 9:68580057-68580079 CAGAACAAAAAGGTGAGAGAAGG + Intergenic
1055078875 9:72246940-72246962 CAGAAAAGAGGGATGAGGGAGGG - Intronic
1055100132 9:72455684-72455706 CAGAACTAAGAAATGAGGAAGGG - Intergenic
1055166072 9:73195587-73195609 CAGAAAAAAAAGGTGAGAGCAGG - Intergenic
1056897753 9:90566698-90566720 CAGCAGAAAGAGGTGAGGGAAGG - Intergenic
1056991989 9:91421431-91421453 CAGAACAAAGGAATGTGGGGAGG + Intronic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1057976433 9:99610405-99610427 GGGCACAAAGAGAGGAGGGCAGG - Intergenic
1059369555 9:113816272-113816294 AAGAAAAAAGAGAGGAGGGGAGG - Intergenic
1059697654 9:116744097-116744119 CAGAAAAAGGAGGTGAGGGTGGG + Intronic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1060318988 9:122537900-122537922 TATAAGAAAGTGATGAGGGCTGG + Intergenic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061588598 9:131584002-131584024 CAGAAGAACGGGCTGAGGGCGGG + Intronic
1061664699 9:132153728-132153750 CAGAACCAAGAGAGGAAGTCGGG + Intergenic
1061882814 9:133576522-133576544 AAGAACAGCGAGGTGAGGGCGGG - Intergenic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062000588 9:134213926-134213948 CAGACCTAGGAGATGAGGGTGGG - Intergenic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1187071100 X:15889227-15889249 AAGAACAAATGGAGGAGGGCAGG + Intergenic
1189368804 X:40411560-40411582 CAGAGTATAGAGATGAGCGCTGG - Intergenic
1189468015 X:41292429-41292451 CAGAAAATAGAAAAGAGGGCTGG + Intergenic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190288867 X:48978596-48978618 CAGAAAAAAGAGCTGAGGCTGGG + Intronic
1190887585 X:54543174-54543196 GAGGACCAGGAGATGAGGGCAGG - Intronic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192265139 X:69532510-69532532 CAGAACAAAGCCATGAAGGGAGG - Intergenic
1195097267 X:101515100-101515122 CAGAAGAAAGGGATGAGCTCAGG - Intronic
1196525263 X:116723040-116723062 CCGCACACAGATATGAGGGCTGG + Intergenic
1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG + Intergenic
1198021428 X:132662230-132662252 ATGAACAAACAGATGAGGGAAGG + Intronic
1199813073 X:151370384-151370406 CAGAACAAAGAGATTTGTACAGG - Intergenic
1200769941 Y:7114916-7114938 CAGATCACAGAAATGAGGTCTGG - Intergenic
1201286028 Y:12379439-12379461 CAGGACCAAGAGAGGAGGGGAGG + Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic