ID: 996384751

View in Genome Browser
Species Human (GRCh38)
Location 5:122899490-122899512
Sequence AGATGGAGCCTGCGAATTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996384751_996384759 17 Left 996384751 5:122899490-122899512 CCTCGAATTCGCAGGCTCCATCT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 996384759 5:122899530-122899552 TCCCAAATAGCTGGGACTACAGG 0: 1660
1: 48171
2: 172714
3: 544294
4: 474639
996384751_996384757 9 Left 996384751 5:122899490-122899512 CCTCGAATTCGCAGGCTCCATCT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 996384757 5:122899522-122899544 TCTTAGCCTCCCAAATAGCTGGG 0: 13
1: 865
2: 17045
3: 149115
4: 458016
996384751_996384756 8 Left 996384751 5:122899490-122899512 CCTCGAATTCGCAGGCTCCATCT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 996384756 5:122899521-122899543 ATCTTAGCCTCCCAAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996384751 Original CRISPR AGATGGAGCCTGCGAATTCG AGG (reversed) Intronic
902889870 1:19434833-19434855 AGATTGAGCCTGGGAGGTCGTGG + Intronic
903799422 1:25955510-25955532 AGCTTGAGCCTGGGAATTCAAGG + Intergenic
904081714 1:27876574-27876596 AGATGGAGCCTGCGGAGACAAGG - Exonic
906351120 1:45060756-45060778 CGATGGAGCCTGGGAGGTCGAGG - Intronic
913214497 1:116609328-116609350 GGCTGGAGCCTGGGAAGTCGAGG - Intronic
915138736 1:153752839-153752861 AGCTGGATCCTTGGAATTCGAGG - Intronic
916861279 1:168808142-168808164 AGATGGAGCCTACTTATTCTTGG - Intergenic
920399384 1:205667794-205667816 AGAAGGATCCTGCTAATTCCTGG - Intronic
920729166 1:208466747-208466769 AGATATAGCCTGTGAATTTGGGG - Intergenic
922054714 1:222029882-222029904 AGATAGAGTCTGCACATTCGAGG - Intergenic
922196321 1:223363547-223363569 GGATGGAGCCTGGGAAGCCGAGG - Exonic
922337206 1:224627549-224627571 AGAGGGAGCCTGTGACTTTGGGG + Intronic
922893631 1:229082142-229082164 AGATTGAGCCTGGGAGTTCAAGG - Intergenic
1065218805 10:23475401-23475423 AGATTGAGCCTGGGAATTTGAGG - Intergenic
1067509933 10:46886167-46886189 AGATGGGGCCTGGGAATTGGTGG + Intergenic
1067652320 10:48165691-48165713 AGATGGGGCCTGGGAATTGGTGG - Intronic
1074816093 10:117141514-117141536 CGCTTGAGCCTGGGAATTCGAGG - Intergenic
1078777886 11:14410467-14410489 TGCTGGAGCCTGGGAGTTCGAGG + Intergenic
1079020272 11:16905166-16905188 ATCTGGAGCCTGGGAAATCGAGG + Intronic
1079548692 11:21667790-21667812 AGATGGAGCAGGCCACTTCGGGG - Intergenic
1080430071 11:32189794-32189816 ATTTGGAGCCTGATAATTCGTGG - Intergenic
1083732659 11:64661131-64661153 AGATGGAGCCTGGGAATCAAGGG + Exonic
1089173998 11:116535404-116535426 AGATGCAGCCTGCGAACGCAGGG + Intergenic
1089563048 11:119355550-119355572 AGCTGGAGCCTGGGTATTTGGGG - Exonic
1095054683 12:37585005-37585027 AGCTGGAGCCTGGGAGGTCGAGG + Intergenic
1097691623 12:62739448-62739470 AGAGGGCCCCTGAGAATTCGGGG + Intronic
1098161728 12:67651894-67651916 TGATGGAGACTGCTAATTCTAGG + Intronic
1101917320 12:108905713-108905735 CGCTGGAGCCTGGGAAGTCGAGG + Intergenic
1102239914 12:111318756-111318778 TGCTTGAGCCTGGGAATTCGAGG - Intronic
1104491597 12:129199191-129199213 TGCTGGAGCCTGGGAAGTCGAGG - Intronic
1105218226 13:18302800-18302822 GGCTGGAGCCTGGGAAGTCGAGG - Intergenic
1105903359 13:24778176-24778198 CGCTGGAGCCTGGGAAGTCGAGG + Intronic
1106805320 13:33300832-33300854 AGAAGGAGGCTGTGAATTTGAGG - Intronic
1108700074 13:52936223-52936245 AGATTGAGCCTGAGAGTTCAAGG + Intergenic
1113853275 13:113430020-113430042 AGATGGAGCCAGCGGCTTCTGGG + Intronic
1114233257 14:20802578-20802600 AGAAGGAGCCTCCAAATTGGGGG - Intronic
1116611139 14:47073689-47073711 TGGTGGTGCCTGAGAATTCGGGG + Intronic
1121895053 14:97639212-97639234 AGCAGGAGCCTGGGAATGCGTGG - Intergenic
1123755789 15:23396814-23396836 TGCTGGAGCCTGGGAGTTCGAGG - Intergenic
1129811697 15:78516427-78516449 TGCTTGAGCCTGGGAATTCGAGG - Intronic
1133880098 16:9773558-9773580 AGATGGAGCCTGGGAAGTTTTGG + Intronic
1136001080 16:27293483-27293505 TGATTGAGCCTGGGAAGTCGAGG - Intergenic
1136102102 16:28003889-28003911 AGATGGAGGCTGGGATTTGGAGG + Intronic
1137613234 16:49833007-49833029 AGATGAAGGCTGCGAACTGGAGG - Intronic
1138568782 16:57854023-57854045 TGCTGGAGCCTGGGAAGTCGAGG - Intronic
1142735706 17:1897646-1897668 AGAGAGAGCCTTCGAATTCTAGG - Exonic
1145375359 17:22342484-22342506 AGCTGGAGCCTGAGAGGTCGAGG + Intergenic
1146192378 17:30780882-30780904 TGCTTGAGCCTGGGAATTCGAGG - Intronic
1147248179 17:39135839-39135861 GGGTGGAGCCTGAGAATTTGTGG + Intronic
1147954880 17:44127282-44127304 CGCTGGAGCCTGGGAAATCGAGG - Intergenic
1152080106 17:78181840-78181862 GGATGGAGCCTGGGAGGTCGAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154104528 18:11509840-11509862 AGATGGAGCCTGGGAGGTTGAGG + Intergenic
1157479737 18:48045680-48045702 AGATGGAGCCTCTGAATTGAGGG - Intronic
1158160847 18:54481364-54481386 AGATGGAGCTTGGAAATTTGTGG - Intergenic
1159351977 18:67286864-67286886 AGATGGAGCCTGAGTCTGCGTGG - Intergenic
1161516006 19:4697013-4697035 TGCTTGAGCCTGGGAATTCGGGG + Intronic
1161826306 19:6568437-6568459 AGCTTGAGCCTGGGAGTTCGAGG + Intergenic
1165113778 19:33516682-33516704 AGATGGAGCCCCTGAATTTGAGG - Intronic
1166092383 19:40518514-40518536 TGCTGGAGCCTGCGAAGTCGAGG - Intronic
1166092431 19:40518810-40518832 CGCTTGAGCCTGCGAATTGGAGG + Intronic
1166691894 19:44826915-44826937 TGATTGAGCCTGGGAGTTCGAGG + Intergenic
930059428 2:47275907-47275929 TGATTGAGCCTGTGAAGTCGAGG + Intergenic
930978714 2:57496030-57496052 AGATGGTGCCTACAATTTCGGGG + Intergenic
931355006 2:61529101-61529123 AGATTGAGCCTGGGAAGTCAAGG + Intronic
933514035 2:83278137-83278159 AGATAGAACCTGGGAAGTCGAGG + Intergenic
934296072 2:91743832-91743854 GGCTGGAGCCTGGGAAGTCGAGG + Intergenic
935535785 2:104292925-104292947 AGATGGAAACTGAGAATTCTAGG - Intergenic
942605541 2:177686481-177686503 AGATTGAGCCTGGGAAGTCAAGG + Intronic
944823296 2:203453460-203453482 CGCTGGAGCCTGAGAAGTCGAGG + Intronic
945068854 2:205971227-205971249 CGCTTGAGCCTGGGAATTCGAGG - Intergenic
945698595 2:213141473-213141495 AGTTGGAGTCTAGGAATTCGAGG - Intronic
946860789 2:223998630-223998652 CGCTGGAGCCTGGGAAGTCGAGG + Intronic
947491390 2:230597981-230598003 GGCTGGAGCCTGGGAAGTCGAGG + Intergenic
1169336780 20:4763305-4763327 TGCTTGAGCCTGGGAATTCGAGG - Intergenic
1169434568 20:5574442-5574464 AGATGGGGCCTGAGAAGTTGCGG + Intronic
1172571968 20:35977592-35977614 TGCTGGAGCCTGGGAAATCGAGG + Intronic
1176265328 20:64206301-64206323 AGATGGAGCCTCTGAAGACGGGG + Intronic
1177454427 21:21317614-21317636 AGCTTGAGCCTGGGAAGTCGAGG - Intronic
1183657092 22:39192642-39192664 CGCTGGAGCCTGGGAATTTGAGG + Intergenic
1185006520 22:48280011-48280033 AGCTTGAGCCTGAGAAATCGAGG + Intergenic
951988095 3:28643307-28643329 GGGTTGAGCCTGAGAATTCGGGG + Intergenic
953163025 3:40439409-40439431 AGATTGAGCCTGGGAAGTCAAGG + Intergenic
955744134 3:62123327-62123349 AGCTGGAGCCTGGGAGTTAGTGG - Intronic
956672029 3:71700088-71700110 AGCTTGAGCCTGGGAAGTCGAGG + Intronic
962105762 3:132387249-132387271 AGATGCATCCTGAGAATTAGAGG + Intergenic
962614401 3:137110346-137110368 AGTTTGAGCCCGGGAATTCGAGG + Intergenic
962681823 3:137808334-137808356 AAAGGGAGCCTGGGAATTCGGGG + Intergenic
965700436 3:171455325-171455347 AGTTTGAGCCTGAGAAGTCGAGG - Intronic
969857224 4:10009947-10009969 GGATGTAGCCTGTGAATTCTTGG + Intronic
975122472 4:70744280-70744302 GGAAGGAGCCTGGGAGTTCGAGG - Intronic
980057031 4:128087793-128087815 TGCTTGAGCCTGCGAATTTGGGG + Intronic
982020307 4:151196343-151196365 GGCTTGAGCCTGGGAATTCGAGG + Intronic
982388645 4:154839526-154839548 TAATTGAGCCTGCGAAATCGAGG + Intergenic
985485320 5:145442-145464 GGCTTGAGCCTGGGAATTCGAGG - Intronic
985991329 5:3564339-3564361 TGTTGGAGCCTGCGAATTAAAGG + Intergenic
987311474 5:16685292-16685314 TGCTTGAGCCTGAGAATTCGAGG - Intronic
988788635 5:34586736-34586758 AGCTTGAGCCTGGGAATTCCAGG + Intergenic
995023996 5:107398115-107398137 AGAGGGAGCCTGGGAAGTTGAGG - Intronic
996384751 5:122899490-122899512 AGATGGAGCCTGCGAATTCGAGG - Intronic
997238952 5:132293567-132293589 ACATGGAGCCTGCGCATTGCGGG - Intronic
1001526879 5:172435504-172435526 TGTTTGAGCCTGGGAATTCGAGG - Intronic
1006053715 6:31364682-31364704 CAATTGAGCCTGCGAGTTCGAGG - Intergenic
1006745721 6:36340732-36340754 GCCTGGAGCCTGCTAATTCGAGG + Intergenic
1011391111 6:86854726-86854748 AGATGGAGCCTTCAACTTGGGGG - Intergenic
1011552300 6:88540823-88540845 AGTTGGAGCCTGCGTGTTCGGGG - Intergenic
1011955569 6:93021211-93021233 AGCTTGAGACTGCGAAGTCGAGG - Intergenic
1018021825 6:159768327-159768349 AGATGAAGTCTGCTAATTCCAGG + Intronic
1024653493 7:51429146-51429168 AGGTGGAGGCTGCGGATACGGGG + Intergenic
1025298071 7:57792567-57792589 AGCTGGAGCCTGGGAGGTCGAGG + Intergenic
1026767267 7:73168049-73168071 TGCTGGAGCCTGAGAAATCGAGG - Intergenic
1026971341 7:74470079-74470101 AGCTGGAGCCTGGGAAATGGAGG - Intronic
1027043735 7:74977758-74977780 TGCTGGAGCCTGAGAAATCGAGG - Intronic
1027079911 7:75224600-75224622 TGCTGGAGCCTGAGAAATCGAGG + Intergenic
1027162392 7:75812166-75812188 AGCTTGAGCCTGGGAATTTGAGG - Intronic
1029281860 7:99440430-99440452 TGCTGGAGCCTGGGAAGTCGAGG - Intronic
1029389122 7:100263189-100263211 TGCTGGAGCCTGAGAAATCGAGG + Intronic
1037278577 8:17209401-17209423 TGCTTGAGCCTGGGAATTCGAGG + Intronic
1042588118 8:70365246-70365268 AGATTGAGCCTGCGAGGTCGAGG + Intronic
1044112706 8:88296099-88296121 TGATGGAGCCTGAAAATTTGAGG - Intronic
1046138794 8:110063205-110063227 AGATGTAGCCTGAGAATTCTGGG - Intergenic
1053045129 9:34909197-34909219 AGCTTGAGCCTGAGAGTTCGAGG - Intergenic
1053795531 9:41723470-41723492 AGCTGGAGCCTGGGAGGTCGAGG - Intergenic
1054149652 9:61591406-61591428 AGCTGGAGCCTGGGAGGTCGAGG + Intergenic
1054183941 9:61935525-61935547 AGCTGGAGCCTGGGAGGTCGAGG - Intergenic
1056897508 9:90564651-90564673 AGAAGGGGCCTGAGAATTGGAGG - Intergenic
1060190181 9:121587741-121587763 AGATGGAACCTGAGAATGCCTGG + Intronic
1061503115 9:131014897-131014919 CGCTGGAGCCTGGGAGTTCGAGG + Intronic
1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG + Intergenic
1192556033 X:72090145-72090167 CACTGGAGCCTGGGAATTCGAGG - Intergenic
1196889714 X:120280210-120280232 AGATTGAGCCTAGGAGTTCGAGG - Intronic
1197703467 X:129616969-129616991 AGGTGGAGCATGCGAAGTGGGGG + Intergenic