ID: 996389275

View in Genome Browser
Species Human (GRCh38)
Location 5:122942357-122942379
Sequence TGTACAGGGTGCTGTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996389275_996389281 10 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389281 5:122942390-122942412 AGGGAACCCTGAGGAAGTAGCGG No data
996389275_996389285 22 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389285 5:122942402-122942424 GGAAGTAGCGGTGGCAATACAGG 0: 1
1: 0
2: 0
3: 3
4: 83
996389275_996389280 1 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389280 5:122942381-122942403 TCTCTTCAAAGGGAACCCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 159
996389275_996389282 13 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389282 5:122942393-122942415 GAACCCTGAGGAAGTAGCGGTGG 0: 1
1: 0
2: 1
3: 7
4: 123
996389275_996389278 -9 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389278 5:122942371-122942393 CCCTGTACATTCTCTTCAAAGGG 0: 1
1: 0
2: 1
3: 10
4: 156
996389275_996389288 25 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389288 5:122942405-122942427 AGTAGCGGTGGCAATACAGGGGG No data
996389275_996389287 24 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389287 5:122942404-122942426 AAGTAGCGGTGGCAATACAGGGG 0: 1
1: 0
2: 2
3: 9
4: 71
996389275_996389276 -10 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389276 5:122942370-122942392 ACCCTGTACATTCTCTTCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 159
996389275_996389286 23 Left 996389275 5:122942357-122942379 CCAGTAGCACAGCACCCTGTACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 996389286 5:122942403-122942425 GAAGTAGCGGTGGCAATACAGGG 0: 1
1: 0
2: 3
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996389275 Original CRISPR TGTACAGGGTGCTGTGCTAC TGG (reversed) Intronic
900236113 1:1591768-1591790 TGTCAATGGTGCTGTGCCACAGG + Intergenic
904029024 1:27522525-27522547 TGGTGACGGTGCTGTGCTACAGG + Intergenic
910194987 1:84630863-84630885 TGTACAGGCTGCTGACCCACAGG + Exonic
914322857 1:146582068-146582090 TATGCTAGGTGCTGTGCTACAGG + Intergenic
915269537 1:154743730-154743752 TCTACAGGGCACTGTGCTGCCGG + Intronic
917295761 1:173517613-173517635 TTTACAGAGTTCTGTACTACTGG - Exonic
920818621 1:209359192-209359214 TGTCCAGGGTTCTGAGCTCCTGG - Intergenic
1066227026 10:33393525-33393547 TGTCCAGGGCTCTGTGATACAGG + Intergenic
1066662968 10:37754575-37754597 TGTGCAGTGGGTTGTGCTACAGG - Intergenic
1067836220 10:49643509-49643531 TGCACTATGTGCTGTGCTACTGG - Intronic
1069887531 10:71633540-71633562 GGGACAGGGTGCTGGGCTCCGGG - Intronic
1072759679 10:98046063-98046085 TGTGCTGGGTGCAGTGCTAACGG + Intergenic
1073073420 10:100808894-100808916 TGTAAAGGGTGCTGTGCCTCCGG + Intronic
1074892912 10:117750163-117750185 TGTACAGGATGCATTTCTACAGG - Intergenic
1075980007 10:126730186-126730208 TGTACAGGATGCTCTTGTACAGG - Intergenic
1076119139 10:127921881-127921903 TGGACAGGGTGCTGTGGCTCAGG + Intronic
1078127009 11:8576070-8576092 TTTACAGGATGCTGTGCCAGAGG + Intronic
1080282026 11:30568447-30568469 TTTGCAGGGTGCTGTACCACAGG - Intronic
1081200388 11:40207868-40207890 TGTAAAGGGTGCTGTGGAACTGG - Intronic
1081792355 11:45797209-45797231 TGTGCAAGGTACTGTGCTAGGGG + Intergenic
1084369692 11:68732495-68732517 TGTGCAGGGTGGTGGGCTCCTGG - Intronic
1085155179 11:74286782-74286804 TGTACCAGATACTGTGCTACAGG + Intronic
1086916144 11:92532059-92532081 TGCACAGGGTGCTTTGCTAGGGG - Intronic
1094020639 12:25910153-25910175 TGTCCAGGATGCTGTGGCACAGG + Intergenic
1095536578 12:43255711-43255733 TGGACTGGGGGCTGTGCTTCTGG + Intergenic
1103833764 12:123802204-123802226 TGTACAGGGTTTTGTGTGACAGG + Intronic
1108065678 13:46575191-46575213 TGGATAGGGTGCAGTGCTGCTGG + Intronic
1112371957 13:98802084-98802106 TGGACAGGGGGCTGTGCTTCAGG + Intronic
1112550296 13:100413621-100413643 TGTACTAGGTGCTGTTCTAAGGG + Intronic
1112703479 13:102038954-102038976 TGTACCAGGTGCTGTACTACTGG + Intronic
1113345920 13:109478352-109478374 TGTTCAGGCTGCTGTGCAGCGGG - Intergenic
1117245327 14:53879196-53879218 TTTACATGATGCTGGGCTACGGG + Intergenic
1119442195 14:74636016-74636038 TGTCCCAGGTGCTGTGCTAGGGG + Intergenic
1119640159 14:76308781-76308803 CAGACAGGGTGCTGTGCTAGGGG + Intergenic
1120649040 14:87109050-87109072 TGAACAGGCTGTTGTGCTATTGG + Intergenic
1120885454 14:89448447-89448469 TGTACAGGATGGTGTGGTGCAGG - Intronic
1121462980 14:94096273-94096295 TCTACTGGCTGCTGTGGTACAGG - Intronic
1125863946 15:43025683-43025705 TGCACAGGGTACTATGCTATGGG + Intronic
1127607812 15:60607225-60607247 TGTACAGTATGCTGTAATACAGG - Intronic
1127697111 15:61461204-61461226 TGTACAGTGTTCTGAGCTTCAGG + Intergenic
1128818316 15:70630129-70630151 TCTGCAGGGTGCTGTGCTCTGGG - Intergenic
1132509817 16:333819-333841 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509829 16:333882-333904 GGTACCTGGTGCTGTGTTACTGG - Intronic
1132509832 16:333913-333935 GGTACTGGGTGCTGTGTTATGGG - Intronic
1132509838 16:333944-333966 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509849 16:334051-334073 GGTACTGGGTGCTGTGTTATGGG - Intronic
1132509859 16:334113-334135 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509864 16:334144-334166 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509874 16:334204-334226 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509882 16:334266-334288 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509896 16:334359-334381 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509919 16:334514-334536 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132509923 16:334545-334567 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132510021 16:335501-335523 GGTACTGGGTGCTGTGTTATTGG - Intronic
1132510030 16:335563-335585 GGTACTGGGTGCTGTGTTATTGG - Intronic
1133856669 16:9556033-9556055 TGCACCAGGTGCTGTGCTAAGGG + Intergenic
1140010704 16:71128782-71128804 TATGCTAGGTGCTGTGCTACAGG - Intronic
1141346685 16:83253033-83253055 TGTGCCAGGTGCTGTGCTAAGGG - Intronic
1143306823 17:5954028-5954050 TATACCAGGTGCTGTGCTGCCGG + Intronic
1147982336 17:44282314-44282336 TGTGCATGGAGCTGTGCTAAGGG - Intergenic
1148938020 17:51180486-51180508 TGTACAGGGGGCTACTCTACTGG - Exonic
1149058768 17:52395982-52396004 TGGACAGGGTGCTGTTCAACAGG - Intergenic
1151852697 17:76700481-76700503 TGTGCAGGGCGCTGGGCTACAGG + Intronic
1152027818 17:77823081-77823103 TGTACAGGGTGCTTTCATAAGGG - Intergenic
1160179874 18:76624772-76624794 TGTTCACGGTGCTGTTCAACAGG + Intergenic
1163368747 19:16890236-16890258 TGGCCATGCTGCTGTGCTACGGG + Exonic
1163485358 19:17582345-17582367 TGTGCAGGGAGCTGAGCTATGGG + Exonic
1168516288 19:57012899-57012921 TGTACTGGATGCTGTCCCACGGG + Intergenic
925033075 2:666440-666462 TGTACAGGCCGCTGTGAAACTGG + Intergenic
925148146 2:1594735-1594757 CGTACCGGGTGCTGTGTCACAGG - Intergenic
925353691 2:3222101-3222123 AGTGCAGGATGCTGTGCTGCTGG - Intronic
925732485 2:6929382-6929404 TGTACAGTGAGCTGGGCTCCTGG + Intronic
928478047 2:31651653-31651675 AGTAGAGGGTGATGTGCTGCAGG - Intergenic
932285102 2:70525203-70525225 TGTCCAGGGTGTTGTGCACCAGG - Intronic
936646468 2:114377824-114377846 TGTACAGGGGTCTTTGCTAGAGG + Intergenic
937218480 2:120327623-120327645 TGTACCCGGCGCTGTGCTGCAGG + Intergenic
937253776 2:120540726-120540748 TGCACAGGGTGCTGGGCGAGGGG + Intergenic
939954884 2:148519465-148519487 TGTACAGGGACCTGTGCTGGAGG - Intergenic
941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG + Intronic
942697814 2:178665636-178665658 TGTACAGGGTGCTAGGGAACTGG - Intronic
944207619 2:197172894-197172916 TGTTCCTGGTGCTGTGCTAGGGG - Intronic
946158806 2:217823598-217823620 TGTAAAGGGTCCTGTGCTGAGGG - Intronic
1168931533 20:1628475-1628497 TGTACAGGGTGGTTTGCCAAAGG + Intergenic
1169429773 20:5526099-5526121 AGTACCGGGTGCTGTGTGACAGG - Intergenic
1170792338 20:19518413-19518435 TATACAGCGTGCTGTGCTGTGGG + Intronic
1172540632 20:35713054-35713076 TGTAGAGCTTGCTGTGCTGCTGG + Exonic
950581210 3:13863256-13863278 TGGACAGGGTGCTGGGCCACAGG - Intronic
952389367 3:32866582-32866604 TAGACATGGTGGTGTGCTACTGG + Intronic
953381051 3:42473245-42473267 GGCACAGGGTGGTGTGCTGCAGG - Intergenic
961499828 3:127324219-127324241 AGCACAGGGTGCTGTGCCCCTGG - Intergenic
964365795 3:155949702-155949724 AGTACAGGGTGCTGGGCTGGTGG + Intergenic
966567520 3:181399460-181399482 TGGAGAAGGTGCTGTGTTACTGG - Intergenic
967074918 3:185993360-185993382 AGGACAGAGTGCTGTGCTAGAGG - Intergenic
968286385 3:197511300-197511322 TGTCCATGGTGCTGTGTGACTGG - Exonic
973343272 4:49027922-49027944 TGTAAAGGGGGCTGTGCTCCTGG + Intronic
977490100 4:97700246-97700268 TGTACAAGCTGCTCTGCCACTGG - Intronic
979633413 4:122929150-122929172 TCTTGTGGGTGCTGTGCTACAGG + Exonic
984926383 4:184810821-184810843 TGTGTCAGGTGCTGTGCTACGGG + Intronic
985682864 5:1265578-1265600 TGCACAGCCTGCTGTGCTCCGGG + Intronic
986849345 5:11793125-11793147 TTTACAGTTTGCTGTGCTATTGG + Intronic
987071208 5:14338629-14338651 GGTCCAGGCTGCTGTGCTCCTGG - Intronic
992670683 5:79057564-79057586 TCCACATGGAGCTGTGCTACTGG - Intronic
992957941 5:81929789-81929811 TGTGCAGGCTGCTGTGCTAGGGG - Intergenic
993090701 5:83422434-83422456 TGTGCTAGGTGCTGTGCTGCTGG - Intergenic
996389275 5:122942357-122942379 TGTACAGGGTGCTGTGCTACTGG - Intronic
997423220 5:133785642-133785664 TGGACAATGTGCTGTGCTTCTGG - Intergenic
997590479 5:135069120-135069142 TGGACAGGGGGCTGAGCCACAGG - Intronic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1003193104 6:3891356-3891378 GGTCCAGGGTGATGTGCTGCAGG - Intergenic
1004061696 6:12204312-12204334 TGTGCAGGGTGCCGTGGTGCTGG - Intergenic
1004512629 6:16295159-16295181 TGAACACGGTGTTGTGCTGCTGG - Exonic
1004662130 6:17719930-17719952 TGTACTGGGTGATGTGCTCTTGG + Intergenic
1006155815 6:32012218-32012240 TGTAGCGGGTGCTGGGCTCCAGG + Intergenic
1006162148 6:32045072-32045094 TGTAGGGGGTGCTGGGCTCCAGG + Exonic
1009000658 6:57709168-57709190 TGATCAGGGTGGTGTGCTAAAGG + Intergenic
1010839895 6:80636572-80636594 TGAACAGGTTGCTGTGAAACTGG + Intergenic
1010934583 6:81846050-81846072 TGCACAGGGTTTTGTTCTACTGG + Intergenic
1011857970 6:91718632-91718654 TGCAAAGGGTGCTGTCCTATCGG + Intergenic
1013174207 6:107663482-107663504 TGTGCAGGGCCCTGTGCTAAGGG + Intergenic
1015795303 6:137005337-137005359 TGGACAGGGTGCAGTGCGAATGG + Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017488988 6:154927639-154927661 TGCACTGGGTCCTGTGCTCCAGG + Intronic
1019067884 6:169317827-169317849 TGAAGAGGGTGCTGTTCTGCCGG + Intergenic
1019490485 7:1311043-1311065 TGTGGAGGGTGCTGGGCTGCGGG - Intergenic
1020057429 7:5127659-5127681 GGTACAGGGTCCTCTGCTCCAGG + Intergenic
1020170321 7:5840011-5840033 GGTACAGGGTCCTCTGCTCCAGG - Intergenic
1020280546 7:6647967-6647989 TGTTCTGGGGGCTGTGCTGCTGG + Intronic
1021959647 7:25858969-25858991 TTTACTGGGGGCTCTGCTACCGG - Intergenic
1022481190 7:30744171-30744193 TGAAAAGGGTGCTGTGCGAGGGG - Intronic
1026069232 7:67102987-67103009 TATGAAGGGTGCTGTGCTTCAGG + Intronic
1026103220 7:67399650-67399672 TGTACAGGGTACTGAAATACTGG + Intergenic
1026661928 7:72309963-72309985 TGAACAGGGTGCAGTGCTCAGGG - Intronic
1026707668 7:72709326-72709348 TATGAAGGGTGCTGTGCTTCAGG - Intronic
1027243241 7:76347129-76347151 AGCCTAGGGTGCTGTGCTACTGG - Intronic
1027829193 7:83155679-83155701 TGTCCAGGCTGCTGTGCTGGAGG + Exonic
1030023057 7:105294232-105294254 TGCAGAGGGTGCTGTGAAACTGG - Intronic
1030877369 7:114831686-114831708 TATCCTGGGTGCTGTGTTACAGG + Intergenic
1031970232 7:128059677-128059699 TGTACATTGTACTGTGGTACAGG + Intronic
1033278300 7:139988883-139988905 TGCTCAGGGTGCTGTGCGATGGG + Intronic
1035353893 7:158265684-158265706 TGTACCCGGGGCTGTGCTGCTGG - Intronic
1035927766 8:3747136-3747158 AGTACAGGCTGCTGTGCTCTTGG - Intronic
1041164940 8:55082063-55082085 TCTAGAGTGTGCTGTGCTGCTGG + Intergenic
1049399247 8:142417518-142417540 TGGACTGGGTGCTGTGGTCCTGG - Intergenic
1051528703 9:18076261-18076283 TTACCATGGTGCTGTGCTACCGG + Intergenic
1051927185 9:22342986-22343008 TGTCCAGGATTCTGGGCTACGGG + Intergenic
1055955562 9:81770146-81770168 TGTACCAGGTACTGTGCTAAGGG + Intergenic
1059742502 9:117165652-117165674 TGTGCTGGGTGCTGGGCTAAGGG - Intronic
1062538490 9:137031307-137031329 TCAACTGGGTGCTGAGCTACCGG - Exonic
1186491146 X:9973526-9973548 TGTAGAGTTTGCTGTGCTCCTGG - Intergenic
1189731974 X:44030448-44030470 TGTAGAGCTTGCTGTGCTGCTGG - Intergenic
1194578863 X:95646384-95646406 TGCACATGGTGCTATGCTAAAGG - Intergenic